ID: 1111510112

View in Genome Browser
Species Human (GRCh38)
Location 13:89250215-89250237
Sequence TAGCCCACCCCATTTGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111510112_1111510115 11 Left 1111510112 13:89250215-89250237 CCATGACCAAATGGGGTGGGCTA No data
Right 1111510115 13:89250249-89250271 GCCTCCATCTCTAGAGCTCAAGG No data
1111510112_1111510118 25 Left 1111510112 13:89250215-89250237 CCATGACCAAATGGGGTGGGCTA No data
Right 1111510118 13:89250263-89250285 AGCTCAAGGCTAAGTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111510112 Original CRISPR TAGCCCACCCCATTTGGTCA TGG (reversed) Intergenic
No off target data available for this crispr