ID: 1111510115

View in Genome Browser
Species Human (GRCh38)
Location 13:89250249-89250271
Sequence GCCTCCATCTCTAGAGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111510112_1111510115 11 Left 1111510112 13:89250215-89250237 CCATGACCAAATGGGGTGGGCTA No data
Right 1111510115 13:89250249-89250271 GCCTCCATCTCTAGAGCTCAAGG No data
1111510107_1111510115 19 Left 1111510107 13:89250207-89250229 CCACTAAGCCATGACCAAATGGG No data
Right 1111510115 13:89250249-89250271 GCCTCCATCTCTAGAGCTCAAGG No data
1111510113_1111510115 5 Left 1111510113 13:89250221-89250243 CCAAATGGGGTGGGCTAGAGAAA No data
Right 1111510115 13:89250249-89250271 GCCTCCATCTCTAGAGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111510115 Original CRISPR GCCTCCATCTCTAGAGCTCA AGG Intergenic
No off target data available for this crispr