ID: 1111510118

View in Genome Browser
Species Human (GRCh38)
Location 13:89250263-89250285
Sequence AGCTCAAGGCTAAGTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111510113_1111510118 19 Left 1111510113 13:89250221-89250243 CCAAATGGGGTGGGCTAGAGAAA No data
Right 1111510118 13:89250263-89250285 AGCTCAAGGCTAAGTGAAAATGG No data
1111510116_1111510118 -10 Left 1111510116 13:89250250-89250272 CCTCCATCTCTAGAGCTCAAGGC No data
Right 1111510118 13:89250263-89250285 AGCTCAAGGCTAAGTGAAAATGG No data
1111510112_1111510118 25 Left 1111510112 13:89250215-89250237 CCATGACCAAATGGGGTGGGCTA No data
Right 1111510118 13:89250263-89250285 AGCTCAAGGCTAAGTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111510118 Original CRISPR AGCTCAAGGCTAAGTGAAAA TGG Intergenic
No off target data available for this crispr