ID: 1111534526

View in Genome Browser
Species Human (GRCh38)
Location 13:89585582-89585604
Sequence GAAAGGATGTGCCTCAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111534526_1111534528 4 Left 1111534526 13:89585582-89585604 CCAACACTGAGGCACATCCTTTC No data
Right 1111534528 13:89585609-89585631 ACATTAACACACAGATTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111534526 Original CRISPR GAAAGGATGTGCCTCAGTGT TGG (reversed) Intergenic
No off target data available for this crispr