ID: 1111536789

View in Genome Browser
Species Human (GRCh38)
Location 13:89612074-89612096
Sequence CCATCCCTCTGGATCCGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 12, 1: 63, 2: 139, 3: 135, 4: 201}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111536789_1111536797 4 Left 1111536789 13:89612074-89612096 CCCTGCCGGATCCAGAGGGATGG 0: 12
1: 63
2: 139
3: 135
4: 201
Right 1111536797 13:89612101-89612123 TAGCAGTGGGTCTACAACGGCGG No data
1111536789_1111536798 11 Left 1111536789 13:89612074-89612096 CCCTGCCGGATCCAGAGGGATGG 0: 12
1: 63
2: 139
3: 135
4: 201
Right 1111536798 13:89612108-89612130 GGGTCTACAACGGCGGCAAACGG No data
1111536789_1111536800 20 Left 1111536789 13:89612074-89612096 CCCTGCCGGATCCAGAGGGATGG 0: 12
1: 63
2: 139
3: 135
4: 201
Right 1111536800 13:89612117-89612139 ACGGCGGCAAACGGCAGTGGTGG No data
1111536789_1111536796 1 Left 1111536789 13:89612074-89612096 CCCTGCCGGATCCAGAGGGATGG 0: 12
1: 63
2: 139
3: 135
4: 201
Right 1111536796 13:89612098-89612120 AGTTAGCAGTGGGTCTACAACGG No data
1111536789_1111536799 17 Left 1111536789 13:89612074-89612096 CCCTGCCGGATCCAGAGGGATGG 0: 12
1: 63
2: 139
3: 135
4: 201
Right 1111536799 13:89612114-89612136 ACAACGGCGGCAAACGGCAGTGG No data
1111536789_1111536801 24 Left 1111536789 13:89612074-89612096 CCCTGCCGGATCCAGAGGGATGG 0: 12
1: 63
2: 139
3: 135
4: 201
Right 1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG No data
1111536789_1111536795 -9 Left 1111536789 13:89612074-89612096 CCCTGCCGGATCCAGAGGGATGG 0: 12
1: 63
2: 139
3: 135
4: 201
Right 1111536795 13:89612088-89612110 GAGGGATGGAAGTTAGCAGTGGG No data
1111536789_1111536794 -10 Left 1111536789 13:89612074-89612096 CCCTGCCGGATCCAGAGGGATGG 0: 12
1: 63
2: 139
3: 135
4: 201
Right 1111536794 13:89612087-89612109 AGAGGGATGGAAGTTAGCAGTGG 0: 2
1: 8
2: 34
3: 141
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111536789 Original CRISPR CCATCCCTCTGGATCCGGCA GGG (reversed) Intergenic
900610006 1:3540677-3540699 CCAGCCCTCTGGATCCTCCAGGG + Intronic
903129677 1:21270578-21270600 CCATCCCACTTGATCCTGCAGGG - Intronic
903135529 1:21307107-21307129 CCCTTCCTCTGGGTCCAGCATGG + Intronic
903340683 1:22652495-22652517 CCCTCCCTCTGCTTCCAGCAGGG - Intergenic
903479131 1:23640163-23640185 CCATGCCTCAGGATCAGGCCTGG - Intronic
904397184 1:30229838-30229860 CCACCCCTCCGGATCCGGCAGGG + Intergenic
906065593 1:42978219-42978241 ATAGCCCTCTGGATCCAGCAAGG + Intergenic
906507519 1:46391138-46391160 CCATCCCTCTGGATCCGGCAGGG - Intergenic
906582997 1:46952052-46952074 CCATCCCTCCAGATCCAGCAGGG + Intergenic
907506066 1:54919098-54919120 CTATCCCTCTGAATCCGGCAGGG - Intergenic
907602957 1:55788499-55788521 CCACCCCTCTGGATACGGCAGGG - Intergenic
907760940 1:57359023-57359045 CCATGACACTGGATTCGGCAAGG + Intronic
908253360 1:62282765-62282787 CCATCCACCTGGATAGGGCAAGG - Intronic
908717670 1:67087564-67087586 CCACCCCTCCAGATCTGGCAGGG + Intergenic
908723217 1:67148181-67148203 CCACCCCTCTGGATCCGGCAGGG - Intronic
908852958 1:68392348-68392370 TCACCCCTCTAGATCCGGCAGGG - Intergenic
908892690 1:68863892-68863914 CCACCCCTCTGGATCCGGCTGGG + Intergenic
909859903 1:80592497-80592519 CCATCCCTCCGGATCCAGCAAGG - Intergenic
910116672 1:83739163-83739185 CCATCCCTCTGGATCCGGCAGGG - Intergenic
910590517 1:88924693-88924715 CCATCTCTCCAGATCCGGTAAGG + Intergenic
911158117 1:94656295-94656317 CCACCCCTCTGAATGGGGCAGGG - Intergenic
912220236 1:107665748-107665770 TCCTCCCTCTGGATCAGGCTGGG - Intronic
912285711 1:108366245-108366267 CCATCCCTCCGGATCCAGCAGGG - Intergenic
912463395 1:109852549-109852571 CCGCCCCTCTGGATCCGGCAGGG - Intergenic
913470774 1:119183083-119183105 CCAACCCTCTGGATCTGGCAGGG - Intergenic
917097523 1:171414028-171414050 CCACCCCTTGGGATCTGGCAGGG - Intergenic
917413373 1:174783115-174783137 CCAGCCCTCTGGATCCTGCAGGG + Intronic
918105640 1:181413265-181413287 CCATGCCTCTTCTTCCGGCAGGG - Intronic
919082771 1:192886750-192886772 CCATACCTCCAGATCCAGCAGGG - Intergenic
919847376 1:201650357-201650379 CCATGCCTCGGGAACTGGCACGG + Intronic
920639843 1:207741471-207741493 CCATTCCTCCGGATCCGGCAGGG - Intergenic
922007929 1:221551008-221551030 CCATCCCTCCAGATCAGGCAGGG - Intergenic
922236605 1:223726953-223726975 CCATCCCTCTGAAACTGGCAGGG - Intronic
922683923 1:227624830-227624852 CCATCCCTCTGGATCTGGCAGGG - Intronic
922685150 1:227633115-227633137 CCACCCCTCCGGATCCGGCAGGG - Intronic
922876314 1:228942559-228942581 CCATGCCTCCAGATCAGGCAGGG + Intergenic
922877778 1:228953937-228953959 CCATCCCTCTGGATCTGGCAGGG + Intergenic
1065222790 10:23513330-23513352 TCACCACTCCGGATCCGGCAGGG - Intergenic
1066246829 10:33591917-33591939 CCATCCCTCTGGATCCAGCAGGG - Intergenic
1066673007 10:37859410-37859432 CCATCCCTCCGGATCTGGCAGGG - Intergenic
1068191622 10:53659799-53659821 CCATCCCTCCGGATCCGGCAGGG + Intergenic
1068988840 10:63130968-63130990 CCACCCCTCTGGATCCATCAGGG - Intergenic
1069037957 10:63664953-63664975 CCACCCCTCTGGATCCCGCAGGG - Intergenic
1071051882 10:81460208-81460230 CCATCCCTCTGGATCCAGCAGGG + Intergenic
1071082695 10:81831265-81831287 CCGCCCCTCTGGATCTGGCAGGG - Intergenic
1071326717 10:84525687-84525709 CCACCCCTCCGGATCTGGCAGGG - Intergenic
1071327406 10:84530627-84530649 CCACCCCTCTGGATCTGGCAGGG - Intergenic
1071557003 10:86612128-86612150 CCATCCCTCCGGTTCCGGCAGGG + Intergenic
1072009068 10:91287787-91287809 CCATCCCTTGGGCTCTGGCATGG + Intergenic
1072378554 10:94841345-94841367 CCATCCCTCCAGATCTGGCAGGG - Intronic
1072472429 10:95724682-95724704 CCACCCCTCTGGATCCAGCAGGG - Intronic
1072518250 10:96208025-96208047 CCATCCCTCTCCACCCTGCAAGG - Intronic
1072650321 10:97290284-97290306 CCATCCCTCCGGATCTGGCAGGG + Intronic
1072795089 10:98348597-98348619 CAATCCCTCCAGATCCCGCAGGG + Intergenic
1072800620 10:98390137-98390159 CCATTCTTCTGGAACAGGCAGGG - Intronic
1073055121 10:100695056-100695078 CCATCCCTCTGAATCTGGGCTGG + Intergenic
1074978457 10:118599842-118599864 CCACCCCTCTGGATGCAGCAGGG - Intergenic
1076280413 10:129242016-129242038 CCTTCCCACTGGGTCCTGCAGGG + Intergenic
1078191869 11:9097735-9097757 CCACCCCTCCAGATCCGGCAGGG + Intronic
1079601735 11:22317894-22317916 CCATCCCTCCGGATGCGGCAGGG - Intergenic
1079692850 11:23441426-23441448 CCATCCCTCCAGATCCGCAAGGG + Intergenic
1079761859 11:24338974-24338996 CCACACCTCTGGATTCTGCAGGG + Intergenic
1079884277 11:25966514-25966536 CCATCCCTCAGGATCCAGCAGGG - Intergenic
1079933248 11:26590768-26590790 CCACCCCTCCGGATCCAGCAGGG - Intronic
1079934234 11:26597487-26597509 CAACCCCTCCAGATCCGGCAGGG - Intronic
1080881476 11:36325314-36325336 CCAACCCTCCAGATCCAGCAGGG - Intronic
1081063041 11:38504043-38504065 CCACCCCTCTGGATCCAGCAGGG + Intergenic
1081069731 11:38595818-38595840 CCATCCCTCTGGATCCAGCAGGG - Intergenic
1081070185 11:38602019-38602041 CCACCCCTTTGGATCCAGCAGGG + Intergenic
1081070868 11:38606892-38606914 CCACCACTTTGGATCCAGCAGGG + Intergenic
1082737613 11:56873947-56873969 CCACCCCTCCAGATCCGGCAGGG + Intergenic
1083107009 11:60368087-60368109 CTACCCCTCCGGATCTGGCAGGG + Intronic
1083992849 11:66257641-66257663 CCCTCCCGCTGGAGCCGGCCCGG + Intronic
1084878733 11:72154347-72154369 CCACCCCTCCAGATCTGGCAGGG + Intergenic
1085041755 11:73330956-73330978 CCAGCCCTCTGGATCCAGGAAGG + Intronic
1085100437 11:73796052-73796074 CCATCACTCTGGCTGCAGCAGGG + Intronic
1085601983 11:77863295-77863317 CCATCCCTCCGGATCCGGCAGGG - Intronic
1085621578 11:78041732-78041754 CCATCCCTCCGGATCTGGCAGGG + Intronic
1085900969 11:80699523-80699545 CCACCCCTCCGGATCCGGCAGGG - Intergenic
1086511201 11:87559874-87559896 CCACCCCTCCAGATCCGGCAGGG - Intergenic
1087901293 11:103644845-103644867 CCACCCCTCCAGATCCGGCAGGG - Intergenic
1088110103 11:106251182-106251204 CTATCCCTCTGGATCTGGCAGGG + Intergenic
1088484615 11:110328699-110328721 CCACCACTCTGGATCAGGCAGGG - Intergenic
1088694727 11:112356888-112356910 CCATCCCCCTGGATACTGGACGG + Intergenic
1092293650 12:7181313-7181335 CCACCCCTCCGGATCTGGCAGGG + Intergenic
1092931314 12:13318408-13318430 CCCTCCCTCTGCCTCAGGCATGG - Intergenic
1093059765 12:14589858-14589880 CCATCACGCTGGCTGCGGCAAGG - Intergenic
1093106654 12:15095414-15095436 CCATCCCTCTGGATCCGGCAGGG - Intergenic
1094641006 12:32275705-32275727 CCATCCCTCCAGATCCGGCAGGG + Intronic
1095138584 12:38636667-38636689 CCACCCCTCCGGATCTGGCAGGG + Intergenic
1095283471 12:40384054-40384076 CTACCCCTCCGGATCTGGCAGGG + Intergenic
1095552479 12:43459213-43459235 CCATCCCTCCGGATCCAACAGGG + Intronic
1095893104 12:47253015-47253037 CCATCCCTCCAGATCAGGCAGGG - Intergenic
1096351226 12:50902814-50902836 CCATTCCTCTGGGTCCGGCAGGG - Intergenic
1096352543 12:50912185-50912207 CCATCCCTCTGGATCTGGCAGGG - Intergenic
1096841844 12:54384703-54384725 CCATTGCTCTGGAGCCAGCAGGG - Intronic
1096939400 12:55325703-55325725 CCATCCCTCCAGATCTGGCAGGG + Intergenic
1097376738 12:58852181-58852203 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1097377746 12:58859310-58859332 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1097840854 12:64320005-64320027 CCATCCCTCCGGATCCGGCAGGG + Intronic
1098639871 12:72825590-72825612 CCATCCCTCCCAATCCAGCAGGG - Intergenic
1098984881 12:77001495-77001517 CCACCCCTCCGGATCTGGCAGGG + Intergenic
1099292623 12:80790120-80790142 CCATCCCTCTGGATCCAGCAGGG + Intergenic
1099605041 12:84794138-84794160 CCACCCCTCCGGATCCGGCAGGG + Intergenic
1100205058 12:92339660-92339682 CCATGCCTCTGGATCTGGCAGGG - Intergenic
1103385547 12:120529395-120529417 CCATGTCTCTGAATCCGGCTAGG + Intronic
1103802563 12:123548840-123548862 CCACCCCTCCGGATCTGGCAGGG + Intergenic
1103804004 12:123558425-123558447 CTAGCCGTCCGGATCCGGCAGGG + Intergenic
1103872333 12:124100795-124100817 CCACCCCTCCGGATCCGGCAGGG - Intronic
1103873171 12:124105970-124105992 CCACCCCTCCGGATCCAGCAGGG - Intronic
1104187860 12:126449627-126449649 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1104850959 12:131873517-131873539 CCACCCCTCTGGATCCGGCAGGG - Intergenic
1107156420 13:37172360-37172382 CCATCCCTCCGGATCCGGCAGGG - Intergenic
1107700917 13:43046824-43046846 ACACCCCTCTGGATCCAGCAGGG + Intronic
1108876210 13:55054068-55054090 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1108877230 13:55061383-55061405 CCATCCCTCCAGATCTGGCAGGG + Intergenic
1109292824 13:60497120-60497142 CCACCCTTCCGGATCCAGCAGGG - Intronic
1109520622 13:63505539-63505561 CCATCCCTCTGGATCCGGCGGGG - Intergenic
1109523580 13:63545099-63545121 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1109594008 13:64525868-64525890 CCATCCCTCCAGATCCAGTAGGG + Intergenic
1109931305 13:69222058-69222080 CCATCCCTCCGGATCCGGCAGGG + Intergenic
1110846151 13:80192475-80192497 CCATCCCTCCGGATCTGGCAGGG + Intergenic
1110987069 13:81984397-81984419 CCATCCCTCCAGATCCGGCAGGG - Intergenic
1111021451 13:82457728-82457750 CCATCCCTCCGGATCCGGCAGGG + Intergenic
1111100903 13:83584903-83584925 CCATCCCTCAGGATCCAGCAGGG - Intergenic
1111174777 13:84580084-84580106 CTGTCCCTCCAGATCCGGCAGGG - Intergenic
1111536789 13:89612074-89612096 CCATCCCTCTGGATCCGGCAGGG - Intergenic
1111709772 13:91796316-91796338 CCAACCCTCCAGATCCGGCAGGG - Intronic
1111820405 13:93206939-93206961 CCATCCCTCCGGATCCGGCAGGG + Intergenic
1113534729 13:111056645-111056667 CCATCTCTCCAGATCCGGCAGGG + Intergenic
1114383856 14:22236779-22236801 CCATCCCTCCAGATCTGGCAGGG + Intergenic
1114384832 14:22243826-22243848 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1114840848 14:26260628-26260650 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1115151668 14:30293310-30293332 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1115757569 14:36544474-36544496 CTATCCCTCCGGATCCGGCAGGG - Intergenic
1116118798 14:40694709-40694731 CCATCCCTCCGGATCCAGCAGGG - Intergenic
1116740335 14:48746746-48746768 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1117171818 14:53108171-53108193 CCATCCCTCCGGATCCGGCAGGG + Intronic
1117453624 14:55876223-55876245 CCACCCCTCTGGAGCTTGCAAGG + Intergenic
1118453508 14:65925210-65925232 CCAACCCTCCGGATCCGGCAGGG - Intergenic
1119089934 14:71772170-71772192 CCATCCCTCCAGATCTGGCAGGG - Intergenic
1119396112 14:74327447-74327469 CCATCCCTGCGGATCAGGAAAGG - Intronic
1119620860 14:76131082-76131104 ACATCCCTCTGGCCCCTGCAGGG + Intergenic
1120097385 14:80403906-80403928 CCATCCCTCTGGATCCAGCAGGG + Intergenic
1120107977 14:80517931-80517953 CCACCCCTCTGGATCTGGCAGGG - Intronic
1120341443 14:83225741-83225763 CCATCCCTCTGAATCCGCCAGGG + Intergenic
1120397392 14:83985627-83985649 CCATCCCTCTGGATCCGGCAGGG + Intergenic
1122001013 14:98653555-98653577 CCATCCTTCCAGATCCAGCAGGG + Intergenic
1122442238 14:101739987-101740009 CACTCCCTCTGCATCCCGCAAGG - Intergenic
1123125468 14:105942912-105942934 CCATCCCTCCGGATCCATCAGGG + Intergenic
1123987301 15:25657076-25657098 CCACCCCTCCGGATCCGGCAGGG + Intergenic
1124421224 15:29524708-29524730 ACACCCCTCTAGATCTGGCAGGG - Intronic
1124956220 15:34362320-34362342 CCATCCCTCTTCATCCTGTAGGG - Exonic
1126153880 15:45547348-45547370 CCCCCCCTCCAGATCCGGCAGGG - Intergenic
1126687466 15:51261013-51261035 CCACCTCTCCGGATCCAGCAGGG + Intronic
1126728333 15:51655589-51655611 CCATCCCTCCGGATCCGGCAGGG - Intergenic
1127074510 15:55312190-55312212 CCATCCCTCCGGATCCAGCAGGG - Intronic
1128363103 15:66976437-66976459 CCACCCCTCCGGATCCAGCAGGG - Intergenic
1129312800 15:74724484-74724506 TCTTCCCTCTGGATCCAGCTGGG - Intronic
1129776369 15:78239282-78239304 CCATCCGTCTGGATCCGGCAGGG - Intronic
1130825964 15:87546647-87546669 CTGTCCCTCTGGATCCGGCAGGG - Intergenic
1131420118 15:92298312-92298334 CCATCCCTCCAGATCTGGCAGGG + Intergenic
1131673855 15:94651185-94651207 CCATCCCTCTGGATCCAGCAGGG + Intergenic
1136223262 16:28842566-28842588 CTATCGCTCTGGAGCCAGCATGG - Exonic
1137941848 16:52695731-52695753 CATTCCCTCTGGAGCCTGCAAGG + Intergenic
1141245301 16:82301721-82301743 TCTTCCCTCTGGATCCTCCAAGG + Intergenic
1141298463 16:82791642-82791664 CCACCCCTCTGGATCCAGCAGGG + Intronic
1141761402 16:86030996-86031018 CCATCTCTCTGGCTCCAGCTGGG + Intergenic
1142278310 16:89134452-89134474 CTATTCCTCCGGATCCCGCAGGG - Intronic
1142327562 16:89426137-89426159 CCATTCCCCTGGATCCGGTGAGG - Intronic
1142626796 17:1197417-1197439 CCATCCCTCTGGCTCCTGACCGG + Intronic
1146824912 17:36013631-36013653 CCCACCCTCTGGATCCTGCCAGG - Intronic
1148371985 17:47106714-47106736 CCATTCCTCCGGATCCAGCAGGG - Intergenic
1148826722 17:50399280-50399302 CCACCCCTCTGGATCTGGCAGGG - Intergenic
1149243102 17:54673728-54673750 CCATCCCTCCAGATCCAGCAGGG - Intergenic
1151017855 17:70577632-70577654 CCACACCCCCGGATCCGGCAGGG + Intergenic
1151224453 17:72638395-72638417 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1151978012 17:77493188-77493210 CCCTCCCTCTGGGTGGGGCAAGG - Intronic
1152377225 17:79925143-79925165 CCATCTCTCTGTCTCAGGCACGG + Intergenic
1152456436 17:80419442-80419464 CCATCGCTCAGCATCTGGCATGG - Intronic
1153400782 18:4682092-4682114 CTGTCCCTCTGGATCTGGCAGGG + Intergenic
1153402064 18:4692050-4692072 CCATCCCTTCGGATCCGGCAGGG + Intergenic
1153819468 18:8820712-8820734 CCAGCCCACTGGACCCTGCATGG + Intronic
1153991347 18:10403421-10403443 CCTTCCCTCGGGATCCACCAAGG - Intergenic
1155749232 18:29399194-29399216 CCATCCCTCCGGATCCAGCAGGG - Intergenic
1156451479 18:37268899-37268921 CCCTCCCTCTTGCTCTGGCAAGG + Intronic
1157782196 18:50449467-50449489 CCATCCCTTCGGATTCGGCAGGG - Intergenic
1158895262 18:61906818-61906840 CCATCCTAATGGATACGGCACGG + Intergenic
1159276127 18:66223482-66223504 CCATCCCTCCAGAACCGGCAGGG + Intergenic
1159279771 18:66270430-66270452 CCATCCCTCCAGATCCAACAGGG - Intergenic
1161397655 19:4052914-4052936 CCCTCCTTCAGGTTCCGGCAAGG + Intronic
1164056878 19:21629520-21629542 TCATCCCTCCAGATCCAGCAAGG + Intergenic
1164173177 19:22745567-22745589 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1165035803 19:33032753-33032775 CCATCCCTCAGTATCAGGAATGG + Intronic
1165448321 19:35868790-35868812 CCATCCCCCAGGACCCGGCCCGG - Intronic
1165823202 19:38690311-38690333 CCACCCCTCCGGATCCAGCAGGG + Intronic
1165825958 19:38705856-38705878 GCATCCGTCTGCATCCGGAATGG + Intronic
1166165570 19:40985928-40985950 CCACCCGTCCGGATCCAGCATGG + Intergenic
1166165659 19:40986579-40986601 CCACCCCTCCAGATCCAGCATGG - Intergenic
1166673017 19:44722801-44722823 CCTTCCCACTGGATCTGGGAGGG - Intergenic
1168121721 19:54255546-54255568 CCCTCCCTCCTGATCCCGCAGGG - Exonic
1168147008 19:54425202-54425224 TCCACCCTCCGGATCCGGCAGGG - Intronic
1168342685 19:55634813-55634835 CCCTCCCTCAGCATCCGGCACGG + Intergenic
924973613 2:153855-153877 CCACCCCTCCGGATCCAACAGGG - Intergenic
924974500 2:160339-160361 CCACCCCTCCGGATCTGACAGGG - Intergenic
925023818 2:592630-592652 CCATCTCTCCAGAGCCGGCAGGG + Intergenic
925384062 2:3449774-3449796 CAAACCCTCTGGGTCAGGCACGG - Intronic
926864991 2:17346356-17346378 CCATTCTTCTGGATCCAGCAGGG + Intergenic
926984535 2:18607816-18607838 CCATCACTCTAGTTCCAGCAGGG - Intergenic
928319130 2:30269307-30269329 CCATCCCTCTGGATCTAGCAGGG + Intronic
928347683 2:30516370-30516392 TCACCGCTCTGGATCCGGCAAGG + Intronic
928440109 2:31285137-31285159 CCACCCCTCCGGATCCAGCAGGG + Intergenic
928671898 2:33610985-33611007 CCACCCCTCCGGATCCAGCAGGG - Intergenic
928676638 2:33657588-33657610 TCACCCCTCCGGATCTGGCAGGG + Intergenic
928773660 2:34732738-34732760 CCATCCCTCTGGATCCAGCAGGG - Intergenic
928979950 2:37127326-37127348 TCATCCCTCTGGTTGCTGCATGG - Intronic
929354363 2:41001739-41001761 CAATCCCTTTAGAGCCGGCAAGG + Intergenic
930485723 2:52008256-52008278 CCACCCCTCCAGATCTGGCAGGG + Intergenic
931038987 2:58275797-58275819 CCATCCGTCCAGATCCGGCAAGG + Intergenic
932271352 2:70413026-70413048 CCAACCCTGTGGTTCCTGCAAGG - Intergenic
932460517 2:71879171-71879193 CCTTCCCTCTGGCTCCATCATGG + Intergenic
932917183 2:75872100-75872122 CTATCCCTCCGGATCCGGCAGGG + Intergenic
932918187 2:75879138-75879160 CTATCCCTCCGGATCCGTCAGGG + Intergenic
933121763 2:78547002-78547024 CCACCCCTCTGGATCTGGCAGGG - Intergenic
933175726 2:79170171-79170193 CCATCCCTCAGGATCCAGCAGGG - Intergenic
933328837 2:80871734-80871756 CCATCCCTCTGGATCCAGCAGGG + Intergenic
933500212 2:83101811-83101833 CCATCCCTCCGGATCCAGCAGGG + Intergenic
934567170 2:95347243-95347265 CCAACCCTCCGGAGCCGGGAGGG - Intronic
934672426 2:96223136-96223158 CCACCCCTCCAGATCCAGCAGGG - Intergenic
935748355 2:106209374-106209396 CCACCCCTCCGGATCCAGCAGGG + Intergenic
936157445 2:110057649-110057671 CCACCCCTGTCGATCTGGCAGGG - Intergenic
936157463 2:110057755-110057777 CCACCCCTGTCGATCTGGCAGGG - Intergenic
936187229 2:110313689-110313711 CCACCCCTGTCGATCTGGCAGGG + Intergenic
936187247 2:110313795-110313817 CCACCCCTGTCGATCTGGCAGGG + Intergenic
937594977 2:123661615-123661637 CCACCCCTCCAGATCTGGCAGGG + Intergenic
937636235 2:124158279-124158301 CCATCCCTCTGTATCCATGAAGG + Intronic
939134078 2:138273473-138273495 CCATCCCTCTGGATCCAGCAGGG - Intergenic
939824471 2:146998547-146998569 CTATCCCTCCGGATCCGGCAGGG + Intergenic
941003042 2:160221410-160221432 CCATCTCTCTGATTCCGACAGGG - Intronic
941971608 2:171356799-171356821 TCATCCATCTGGAACAGGCAAGG + Intronic
942580686 2:177412964-177412986 CCACCCCTCCAGATCCAGCAGGG - Intronic
942679495 2:178462582-178462604 CCATCCCTCTGAATCTGGCAGGG + Intergenic
942830315 2:180232101-180232123 CCACCCCTCAGGGTCCGTCAGGG + Intergenic
943019263 2:182552947-182552969 CCATCCCTCCAGATCCAGCAGGG + Intergenic
943462360 2:188184642-188184664 CCATGCCTCCGGATCTGGCAGGG - Intergenic
944039784 2:195339894-195339916 CCACCCCTCCGGATCTGGCAGGG - Intergenic
945064780 2:205939588-205939610 CCATCCCTCCGGATCCAGCAGGG + Intergenic
945395006 2:209306632-209306654 CCATCCCTCCGGATCCAGCAGGG + Intergenic
945498808 2:210542920-210542942 CCTTCCCTGTGGATCAGGCTAGG - Intronic
945999676 2:216470978-216471000 CCATCTCTCTGGGGCCAGCATGG - Intronic
946816307 2:223582139-223582161 CCATCCCACTTGCTCAGGCATGG - Intergenic
947327461 2:228993295-228993317 CCATCACTCTGGCTGCAGCAGGG - Intronic
947442598 2:230136389-230136411 CCCTCCCTCTGGATCTGAAATGG - Intergenic
948517652 2:238514244-238514266 CCACCCCTCTGGATCCGGCAGGG + Intergenic
948689942 2:239695564-239695586 CCTGCCCTCTGGCTCCGGCAGGG - Intergenic
948945139 2:241215539-241215561 CCATCTCTCGGGATGTGGCATGG - Intronic
1171500785 20:25591446-25591468 CCATCCCTCCGGATCTGGCAGGG - Intergenic
1172947204 20:38698791-38698813 CCACCCCTCTGGATCAGGCAGGG + Intergenic
1173276255 20:41586286-41586308 TCACCCCTCCGGATCCGGCAGGG + Intronic
1173450843 20:43162632-43162654 CCATCACTCTGGAGGCAGCAAGG + Intronic
1176987654 21:15456093-15456115 CCATCCCTCGTCATCAGGCAGGG - Intergenic
1177263969 21:18760106-18760128 CCATCCCTCCGGATCCGGCAGGG - Intergenic
1177359352 21:20048603-20048625 CCACCCCTCCGGATCCGGCACGG - Intergenic
1177426362 21:20927710-20927732 CCACCACTCCAGATCCGGCAGGG + Intergenic
1177531186 21:22360103-22360125 CCATCCCTCCAGATCTGGAAGGG - Intergenic
1177738133 21:25118822-25118844 CCACCCCTCCGGATCCGGCAGGG + Intergenic
1177895740 21:26854857-26854879 CCATCCCTCTAGATCTGGCAGGG + Intergenic
1177896712 21:26861691-26861713 CCATCCCTCCAGATCTGGCAGGG + Intergenic
1178687616 21:34723644-34723666 CCATCCCTCAGGGTCAGGCGAGG - Intergenic
1180703004 22:17791875-17791897 CTCTCCCGCTGGATCCCGCATGG + Intronic
1180995008 22:19961243-19961265 CCAGCCCTCTGGCTGCGGGAGGG - Exonic
1182221368 22:28761591-28761613 CCATCCCTCTGGATCCAGCAGGG + Intergenic
951016250 3:17735764-17735786 CCACCCCTCCAGATCCAGCAGGG - Intronic
951201165 3:19876427-19876449 CCATCCCTCTGAATCTGGCAGGG - Intergenic
951326066 3:21303088-21303110 CCATCCCTCCAGATCCGGCAGGG - Intergenic
951837652 3:27001182-27001204 CCATCCCTCCAGATCTGGCAGGG + Intergenic
952921707 3:38289735-38289757 CCACCCCTCCGGATCTGGCAGGG - Intronic
952922689 3:38296882-38296904 CCACCCCTCCGAATCTGGCAGGG - Intronic
953505903 3:43485307-43485329 CCATACCTCCGGATCCGACAGGG + Intronic
953515831 3:43591234-43591256 CCATCCCTCCAGATCAGGCAGGG + Intronic
955381268 3:58440177-58440199 CCACCCCTCTGGATCCGGCAGGG - Intergenic
956564250 3:70617529-70617551 CCATCCCTCCAGATCTGGCAGGG + Intergenic
957000498 3:74877898-74877920 CCATCCCTCCGGATCCGGCAGGG - Intergenic
957296903 3:78344224-78344246 CCATCCCTCTAGATCCAGCAGGG - Intergenic
957687051 3:83515334-83515356 CCATCCCTCCGGATGCGGCAGGG + Intergenic
957895115 3:86412003-86412025 CCACCCTTCTGGATCCGGCAGGG + Intergenic
958016738 3:87946192-87946214 CCACCCCTCTGGATCCGGCAGGG - Intergenic
958091887 3:88886793-88886815 CCACCCCTCTGGATCCGGCAGGG - Intergenic
958424512 3:93965317-93965339 CCATCCCTCCGGATCCGGAAGGG + Intronic
958457043 3:94345271-94345293 CCACCGCTCCGGATCCGACAGGG - Intergenic
958629239 3:96666787-96666809 CCATCCCTCTGGATCCGGCAGGG - Intergenic
958630361 3:96675005-96675027 ACATCCCTCCGGATCTGGCAGGG - Intergenic
959161766 3:102732773-102732795 CCATCCCTCCGGATCCAGCAGGG - Intergenic
959406350 3:105966208-105966230 CCACCCTTCCAGATCCGGCAGGG + Intergenic
959450007 3:106487159-106487181 CCATTCTTCCGGATCCAGCAGGG - Intergenic
959885712 3:111497357-111497379 TCATCCCTCTGGATTTGGCAGGG - Intronic
963255688 3:143142531-143142553 CCACCCCTCCGGATCCGGCAAGG + Intergenic
963492277 3:146016781-146016803 CCATTCTTCCGCATCCGGCAGGG + Intergenic
963575893 3:147060196-147060218 CCATCCCTCCAGATCTGGCAGGG + Intergenic
963915319 3:150854417-150854439 CCATCCCTCTGGATCTGGCAGGG + Intergenic
965054286 3:163694792-163694814 TCACTCCTCTGGATCAGGCAGGG - Intergenic
965342125 3:167503663-167503685 CCATCCCTCTGGATCTGGCAGGG - Intronic
966353276 3:179054765-179054787 CCATGCCTCCGGATCCAGCAGGG + Intronic
966511216 3:180765629-180765651 TCACCCCTCCGGATCCGGCAGGG - Intronic
966994315 3:185265059-185265081 CCACCCCTCCGGATCCGGCAGGG + Intronic
967389154 3:188938539-188938561 CCATCCCCCTGGATCCCGCAGGG - Intergenic
967623107 3:191658955-191658977 CCATCCCTCCGCATCCAGCAGGG + Intergenic
968390866 4:192099-192121 CCAACCTTCTGGATCCAGCAGGG - Intergenic
969162624 4:5274841-5274863 TCATCCCTCCAGATCCAGCAGGG + Intronic
969644669 4:8420789-8420811 CCACCCCTCCGGATCCAGCAGGG + Intronic
970095535 4:12459592-12459614 CCATCCCTGCGGATCCGGCAGGG + Intergenic
970155090 4:13133633-13133655 CCACCTCTCTGGCTCCAGCAGGG - Intergenic
970738106 4:19198095-19198117 CCATCCCTCTGGATCCAGCAGGG - Intergenic
971076785 4:23158421-23158443 CCACCCTTCCGGATCTGGCAGGG + Intergenic
971980357 4:33742991-33743013 CCATTCTTCTCGATCCAGCAGGG + Intergenic
972766764 4:42158524-42158546 CCATCCCTCTGGATCTGGCAGGG - Intergenic
972781771 4:42292454-42292476 CCACCCCTGCGGATCTGGCAGGG - Intergenic
972853848 4:43082264-43082286 CCATCCCTCCAGATCTGGCAGGG + Intergenic
973205062 4:47550804-47550826 CCACCCCTGCGGATCTGGCAGGG - Intronic
973245870 4:48010793-48010815 CCATCCCTCTGGATCCGGCAAGG - Intronic
974487288 4:62522475-62522497 CTACCCCTCCGGATCCAGCAGGG + Intergenic
974487843 4:62526851-62526873 CCATCCCTCTGGATCTGGCAGGG - Intergenic
974519967 4:62971439-62971461 CCAGCCCTCCGGATCCGGCAGGG + Intergenic
974520768 4:62977424-62977446 CCACCCCTCCAGATCCAGCAGGG + Intergenic
974648491 4:64724938-64724960 CCACCCCTCTGGATCCAGCAGGG - Intergenic
974841803 4:67307641-67307663 CCACCTCTCCAGATCCGGCAGGG + Intergenic
975313219 4:72925981-72926003 CCATCCCTCTGGATCCGGCAGGG - Intergenic
975314184 4:72932743-72932765 CCATCCCTCCGGATCTGGCAGGG - Intergenic
975418812 4:74138632-74138654 CCACTCCTCCGGATCCAGCAGGG - Intronic
976189296 4:82473738-82473760 CCACCCCTCCGGATCCAGCAGGG + Intergenic
976464843 4:85355197-85355219 CCACCCCTCCGGATCTGGCAGGG - Intergenic
977251328 4:94692671-94692693 CCACCCCTCTGGATCCGGTAGGG + Intergenic
977556184 4:98489624-98489646 CCACCCCTCCGGATCCGGCAGGG + Intronic
978587020 4:110284256-110284278 CCATCCCTCCGAATCCGGCAGGG - Intergenic
978909027 4:114044544-114044566 CCATCCCTCCGGATCCAGCAGGG + Intergenic
979136000 4:117113853-117113875 CTATCCCTCCAGATCGGGCAGGG - Intergenic
979910837 4:126363718-126363740 CCATCCCTCCAGATCTGGCAGGG + Intergenic
980190527 4:129519371-129519393 CCATCCCTCTGGATCCCGCAGGG + Intergenic
980443825 4:132882461-132882483 CTACCCCTCTGAATCTGGCAAGG + Intergenic
980523658 4:133961759-133961781 CCACCCCTCCAGATACGGCAGGG + Intergenic
980625724 4:135372344-135372366 CCATCCCTCTGGTTCCAGCAGGG + Intergenic
980683945 4:136201413-136201435 CCATCCTTCCGGATCTGGCAGGG + Intergenic
980790439 4:137613314-137613336 CCATCCCTGCGGATCCTGCAGGG + Intergenic
980871964 4:138622092-138622114 CCACCCCTCCAGATCCAGCAGGG - Intergenic
981740766 4:147999480-147999502 CCATCCCTCCGGATCCGGCAGGG + Intronic
982978791 4:162104114-162104136 CCATCCCTCCGGATCCAGCAAGG + Intronic
983777803 4:171629926-171629948 CCATCCCTCTGGATCCGGCAGGG + Intergenic
985226364 4:187765563-187765585 CCATCCCTCCGGATCCAGCAGGG + Intergenic
986492610 5:8307802-8307824 CCACACCTCAGGATCCGGCAGGG - Intergenic
986918834 5:12660718-12660740 CCATCCCTCCGGATCCACCAGGG - Intergenic
987129619 5:14848566-14848588 CCACCCCTCCAGATTCGGCAGGG + Intronic
987502696 5:18733522-18733544 CCATCCCTTCGGATCCGGCAGGG - Intergenic
987508234 5:18800470-18800492 CCATCCCTCCGGATCCGGCAGGG + Intergenic
987719407 5:21615308-21615330 CCACCCTTCTGGATCTGGCAGGG - Intergenic
987761175 5:22164439-22164461 CCATCCCTCAGGATCCAGCAGGG - Intronic
987855132 5:23411346-23411368 CCACCCCTCCGGATCCAGCAGGG + Intergenic
987934899 5:24451245-24451267 CCACCCCTCCAGATCCGGCAGGG - Intergenic
987934910 5:24451312-24451334 CCACCCCTCCGGATCCAGCAGGG - Intergenic
988099678 5:26660306-26660328 CCACCCCTCCGGATCTGACAGGG - Intergenic
988182546 5:27816269-27816291 CCACCCCTCTGGATCCCGCAGGG - Intergenic
988881482 5:35508174-35508196 CCACCCCTCTGGATCCAGCAAGG + Intergenic
988957389 5:36332934-36332956 CCATCCTTCTGGATCCAGCAGGG - Intergenic
989717706 5:44483538-44483560 CCACCCCTCTGGATCCGGAAGGG + Intergenic
990478811 5:56187587-56187609 CTATCCCTCTGGATCCAGCAGGG + Intronic
990741381 5:58915966-58915988 CTATCCCTCTGGATCTGGCAGGG + Intergenic
990891816 5:60658917-60658939 CCACCCCTCCGGATCCAGCAGGG + Intronic
990892813 5:60666123-60666145 CCACCCCTCCAGATCCGGGAGGG + Intronic
990905187 5:60795661-60795683 CCAACCCTCCGGATCCGGCAGGG + Intronic
991290620 5:65030902-65030924 CCATCCGTCCAGATCCAGCAGGG + Intergenic
991895965 5:71397893-71397915 CCATCCCTCAGGATCCAGCAGGG - Intergenic
992293504 5:75304616-75304638 CCACCCCTCTGGATCTGGCAGGG + Intergenic
992917188 5:81468890-81468912 CCTAACCTCTGGATCAGGCATGG + Intronic
993054981 5:82970942-82970964 CCATCCCTCCGGATCCAGCAGGG - Intergenic
993225650 5:85165372-85165394 CCATCCCTCCAGATCCAGCAGGG + Intergenic
993305764 5:86272975-86272997 CCATCCCTCCGGATCTGGCACGG - Intergenic
993460750 5:88177684-88177706 CCATCCCTCCAGATCTGGCAGGG - Intergenic
993622817 5:90188232-90188254 CCACCCCTCTGGATCCAGCAGGG - Intergenic
993982345 5:94557938-94557960 CCATCCCTCTGGATCTGGCAGGG + Intronic
995125588 5:108574443-108574465 CCATCCCTCCAGATCCAGCAGGG - Intergenic
995466160 5:112451139-112451161 CCATCCCTCCAGATCTGGCAGGG + Intergenic
995541634 5:113191450-113191472 CCTGCCCTCTGGATTCGGTAGGG - Intronic
995717286 5:115092662-115092684 CCACCCCTCCGGATCTGGCAGGG + Intergenic
995785073 5:115819044-115819066 CCACCCCTCCAGATCCGGCAGGG - Intergenic
996128280 5:119751571-119751593 CCATCCCTCCAGATCCGGCAGGG + Intergenic
996939807 5:128990896-128990918 CCACCCCTCCAGATCCAGCAGGG - Intronic
998122116 5:139587293-139587315 CCATCCCTCCGGATGGAGCAGGG - Intronic
998644322 5:144045580-144045602 CCATCCCTCCAGATCCAGCAGGG + Intergenic
998665971 5:144297981-144298003 TCATCCCTCTGGATTCGGCAGGG + Intronic
999281526 5:150369512-150369534 CCATCCCTGAGGATCGGACACGG - Exonic
1000095460 5:157967416-157967438 CCATCCCTCCGGAACCGGCAGGG + Intergenic
1001597148 5:172905652-172905674 CCACCCCTCTGGATCCGGCAGGG - Intronic
1004236366 6:13878502-13878524 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1004256420 6:14068854-14068876 CCATCCCTCCGGATCTGGCAGGG + Intergenic
1005324130 6:24682630-24682652 CCATCCCTCCGGATCCAGCAGGG - Intronic
1007011961 6:38426569-38426591 CCATTCTTCCGGATCCGGCAGGG + Intronic
1008582767 6:52921471-52921493 CCATACCTCTGGATCCAGCAGGG - Intergenic
1008957339 6:57230169-57230191 CCATCCCCCAGGATCCTGAATGG - Intergenic
1009519540 6:64664028-64664050 CCATCCCTCCAGATCGGGCAGGG - Intronic
1009702467 6:67201760-67201782 CCACCCCTCTGGATATCGCAGGG + Intergenic
1009885213 6:69617071-69617093 CAACCCCTCTGGATCTGGCAGGG + Intergenic
1010895036 6:81351524-81351546 CCATTCTTCCGGATCTGGCAGGG + Intergenic
1011189079 6:84712021-84712043 CCACCCCTCTGGATCTGGCAGGG - Intronic
1011540383 6:88421313-88421335 CCATCCCTCTGAATCCGGCAGGG - Intergenic
1012120023 6:95354776-95354798 CCACCCCTCCGGATCCAGCAGGG + Intergenic
1012734532 6:102921656-102921678 CCATCCCTCCGGATCTGGCAGGG - Intergenic
1013021764 6:106228301-106228323 CCATCCCTCTGGATCTAGCAGGG + Intronic
1013410515 6:109879646-109879668 CCACCCCTCTGGATCTGGCAGGG + Intergenic
1013543082 6:111131184-111131206 CCACCCCTCTGGATCCGGCAGGG + Intronic
1014208920 6:118687799-118687821 CCATCCCTCCAGATCTGGCAGGG + Intronic
1014243348 6:119041704-119041726 CCACCCCTCCGGATCCGGCAGGG + Intronic
1015632773 6:135247991-135248013 CCACCCCTCTGGATCCAGCAGGG + Intergenic
1016343643 6:143087521-143087543 CCATCCCTCTGGATCTGGCAAGG - Intronic
1016444918 6:144121377-144121399 CCACCCCTCCGGATCCAGCAGGG - Intergenic
1017622800 6:156316564-156316586 CCATCCATGTGGATCCAGAAAGG + Intergenic
1017868997 6:158470199-158470221 CCATCCCTCCGAATCTGGCAGGG - Intronic
1018760558 6:166891239-166891261 CCATCCCTCCGGATCCTGCAGGG + Intronic
1018770884 6:166970758-166970780 CCATCCTTCTGAATCTGGGAGGG + Intergenic
1019039822 6:169094470-169094492 CCATCCCTCTGGGTCTGCCTTGG + Intergenic
1020906215 7:14067257-14067279 CCATCCCTCCAGATCTGGCAGGG + Intergenic
1021144261 7:17065947-17065969 CCACCCCTCCAGATCGGGCAGGG + Intergenic
1021885333 7:25131906-25131928 CCATCCCTCCGGATCCAGCAGGG - Intergenic
1022090813 7:27106898-27106920 GCAGCCCTCTGGCTCCAGCATGG - Exonic
1022117661 7:27276512-27276534 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1022505721 7:30907794-30907816 CCATTCCTCTGGGGCCAGCAGGG - Intergenic
1022989921 7:35696686-35696708 CCATCCCTCTGGATCCAGCGAGG + Intergenic
1023438994 7:40167775-40167797 CCACCCCTCCAGATCTGGCAGGG - Intronic
1023439765 7:40173321-40173343 CCACCCCTCCGGATCTGGCAGGG - Intronic
1023733128 7:43210797-43210819 CCACCCCTCTGGATCTGGCAGGG - Intronic
1025716569 7:63962592-63962614 CCATCCCTCCAGATCCGGCAGGG - Intergenic
1026213089 7:68324156-68324178 CCATCCCTCCGGATCCAGCAGGG + Intergenic
1026268079 7:68812876-68812898 CCATCCCTTTGTTTCCCGCAAGG - Intergenic
1026346978 7:69482852-69482874 CCACCCCTCCAGATCCGGCAGGG + Intergenic
1027868356 7:83675029-83675051 CCATACCTCCGGATCCGGCAGGG - Intergenic
1028013992 7:85684152-85684174 CCATCCCTCCAGATCCAGCAGGG + Intergenic
1028147059 7:87330027-87330049 CCACCCCTCTGGATCCAGCAGGG - Intergenic
1028587718 7:92468264-92468286 CCATCCCTCTGGATCATGCAGGG - Intergenic
1028589081 7:92477751-92477773 CCATCCCTCTGGATCCTGCAGGG - Intronic
1028926143 7:96358676-96358698 CCACCCCTCTGGATCCGGCAGGG - Intergenic
1028993394 7:97074837-97074859 CCATCCCTCCGGATCCGACAGGG + Intergenic
1029015978 7:97315978-97316000 CCATCCCTCTGGATCTGGCAGGG + Intergenic
1029207894 7:98879708-98879730 CCAGCCCTCTGGCTCCGGGTAGG - Intronic
1029488764 7:100858987-100859009 CCATCCCCCTGGGTCCCTCACGG - Intronic
1030208389 7:106972732-106972754 TCACCCCTCCGGATCCGGCCAGG - Intergenic
1030336815 7:108337451-108337473 CCATCCCTCTGGATCTGGCAGGG + Intronic
1030431262 7:109452224-109452246 CCACCCCTCCGAATCCCGCAGGG + Intergenic
1030843972 7:114386114-114386136 CCATCCCTCTGGATCCGGCAGGG - Intronic
1031250868 7:119378909-119378931 CCACCCCTCTGGATCCGGCAGGG - Intergenic
1031299582 7:120047511-120047533 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1031472006 7:122177236-122177258 CCACCCCTCCGGATCCATCAGGG + Intergenic
1031742818 7:125455898-125455920 CCATCCCTCCGGATCCGGCAGGG - Intergenic
1032425783 7:131821157-131821179 CCACCCCTCTGGATCCGGCAGGG - Intergenic
1032653851 7:133906731-133906753 CCATCCCTCCAGATCCGGCAGGG + Intronic
1032725349 7:134585844-134585866 CCACCTCTCTGGATCAGGCAGGG + Intergenic
1032726301 7:134592677-134592699 CCACCTCTCTGGGTCCAGCAGGG + Intergenic
1034248775 7:149671742-149671764 CCACCCCTCTGGATCTGGCAGGG + Intergenic
1034249503 7:149676862-149676884 CCACCCTTCTGGATCCAGCAGGG + Intergenic
1034650836 7:152688820-152688842 CCATCCCTCCGGATCCGGCAGGG - Intergenic
1034707070 7:153155163-153155185 CCACCCCTCTGGATTTGGCAGGG - Intergenic
1034759418 7:153657430-153657452 GCATCCCTCTGGATCCTACTCGG + Intergenic
1034965003 7:155385365-155385387 CCATCCCTCCGGATCCAGCAGGG - Intronic
1036445986 8:8822365-8822387 CTGTCCCTCTGCATCAGGCATGG - Intronic
1037379951 8:18274615-18274637 CCACCCCTCAGGATCCAGCAGGG - Intergenic
1037570611 8:20154881-20154903 CCACCCCTCCAGATCTGGCAGGG + Intronic
1037648683 8:20817019-20817041 CCATCCCTCCGGATCCGTCAGGG - Intergenic
1038742243 8:30225901-30225923 CCATCCCTCTGGATCCGGCAGGG - Intergenic
1039581983 8:38674584-38674606 CACTCCCTCTGGAGGCGGCAGGG + Intergenic
1040768446 8:50944260-50944282 CCACCCCTCCGGATCCAGCAGGG - Intergenic
1041664086 8:60425331-60425353 CCACCCCTCGGGATCCGGCAGGG - Intergenic
1041741907 8:61165197-61165219 CCATTCTTCCGGATCCAGCAGGG - Intronic
1042055662 8:64763122-64763144 CCACCCCTCCGGATCCAGCAGGG + Intronic
1043087302 8:75850091-75850113 CCATCACTCTGGCTCCAGCAGGG - Intergenic
1044988284 8:97774156-97774178 CCACCCCTCTGGATCCGGCAGGG - Intergenic
1045657597 8:104403161-104403183 CCATCTCTCCAGATCTGGCAGGG + Intronic
1045664329 8:104468973-104468995 CCACCCCTCTGAATCCAGCAGGG + Intergenic
1045788631 8:105955513-105955535 CTATCCCTCCAGATCTGGCAGGG - Intergenic
1045863507 8:106839349-106839371 CCACCCCTCAGGATCCGGCAGGG - Intergenic
1047276659 8:123410808-123410830 CTATCCCTCCAGATCCGGCAGGG + Intronic
1047443554 8:124900100-124900122 TCACCCCTCTGGATCTGGCAGGG - Intergenic
1047599738 8:126413925-126413947 CCACCCCTCCAGATCCGGTAGGG - Intergenic
1047618320 8:126581368-126581390 CCACCCCTCCGGATCTGGCAGGG + Intergenic
1048100250 8:131343185-131343207 CCACCCTTCTGGATCCGGCAGGG - Intergenic
1048374993 8:133815482-133815504 CCATCCCTCAGTATCCATCAAGG + Intergenic
1048631499 8:136247692-136247714 CCACCCCTCTGGATCTGGCACGG + Intergenic
1049257639 8:141622408-141622430 CCACCCCTCTGTCTCTGGCAGGG + Intergenic
1049432357 8:142571258-142571280 CCATCCCTCTGCCCCAGGCATGG - Intergenic
1050116051 9:2264560-2264582 CCACCCCTCCGGATCCGGCAGGG - Intergenic
1050593508 9:7183588-7183610 CCATCCCTCTGGATCAGGCAGGG + Intergenic
1051699186 9:19801375-19801397 CCATCCCTCGGCATCCAGCAGGG - Intergenic
1051870083 9:21727308-21727330 CCATCCCTTCAGATCCGGCAGGG + Intergenic
1051970169 9:22878030-22878052 CCATCCCTCCGGATCCAGCAGGG - Intergenic
1052990776 9:34518360-34518382 CCATCCCTCTGGTGCTGGCTTGG + Intronic
1053134326 9:35640620-35640642 CCATCCCTCCAGATCCGGCAGGG - Intronic
1053215200 9:36265056-36265078 CCACCCCTCCGGATCTGGCAGGG + Intronic
1055049588 9:71964991-71965013 CCATCCCTCTGGATCCGGTAGGG - Intronic
1055431335 9:76247177-76247199 CCATCCCTCCAGATCAGGCAGGG - Intronic
1055455704 9:76469652-76469674 CCATCCCTCTGGATCAGGCAGGG + Intronic
1056705005 9:88944236-88944258 CCATCCCTCTGGATCTGGCAGGG - Intergenic
1058758514 9:108106062-108106084 CCACCCCTTTGGTTCCTGCAGGG + Intergenic
1061004265 9:127919539-127919561 CCACCCATCTGGATCCCACAGGG - Intergenic
1061037567 9:128122110-128122132 CCGGGCCTCTGGATCCAGCAGGG + Intronic
1061239388 9:129360337-129360359 TAAGCCCTCTGGACCCGGCATGG - Intergenic
1061786380 9:133030993-133031015 CCATCCCTGTGCGTCTGGCAGGG - Exonic
1185560920 X:1060119-1060141 CCACCCCTCCGGATCAGGCAGGG + Intergenic
1186254528 X:7703880-7703902 CCATCCCTCTGGATCCGGCAGGG - Intergenic
1186826275 X:13343208-13343230 CTCTCCCTCTGGATCCAGGAAGG - Intergenic
1187613825 X:20971901-20971923 CCATCCCTCAGGATCTGCCAGGG + Intergenic
1188157316 X:26755943-26755965 CACCCCCTCTGGATCCGGCAGGG - Intergenic
1189152090 X:38719466-38719488 CCAACCCTCCAGATCCAGCAGGG - Intergenic
1189954268 X:46261956-46261978 CCATCCCTCCGGATCTGGCAGGG - Intergenic
1190240568 X:48654947-48654969 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1190368111 X:49716717-49716739 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1191167478 X:57405515-57405537 CCACCACTCTGGATCTGGCAGGG - Intronic
1192254883 X:69448024-69448046 CCACCCCTCCAGATCTGGCAGGG + Intergenic
1192803101 X:74485839-74485861 CCACCCCTCCGGATCCGGCAGGG - Intronic
1192961005 X:76130784-76130806 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1193164349 X:78264188-78264210 CCATCTCCCTGGCTCTGGCAGGG + Intergenic
1193172379 X:78350328-78350350 CCTCCCCTCTGGATCCAGCAGGG - Intergenic
1193295486 X:79827523-79827545 CCATCCCTCCGGATATGGCAGGG - Intergenic
1193306259 X:79956083-79956105 CCATGCCTCCAGATCCAGCAGGG + Intergenic
1193916010 X:87364651-87364673 CCATCCCTTTGTTTCCGGTAGGG + Intergenic
1194103273 X:89734542-89734564 CCATCCCTCCGGATCCCGCAGGG - Intergenic
1194154497 X:90370255-90370277 CCATCTCTCTGGATCCGGCAGGG - Intergenic
1194445392 X:93981447-93981469 CCATCACTCCGGATCCGGTAGGG - Intergenic
1195154922 X:102113493-102113515 CCAGGCCTCTGAATCCGCCAGGG - Intergenic
1195243675 X:102977856-102977878 TCACCCCTCCGGATCCAGCAGGG + Intergenic
1195256579 X:103096819-103096841 CCACCCCTCCGGATCCAGCAGGG + Intergenic
1195505074 X:105647190-105647212 CCACCCCTCCGGATCTGGCAGGG - Intronic
1195584612 X:106551436-106551458 CCATCCCTCTGGATCTGGCAGGG + Intergenic
1196258162 X:113547158-113547180 CCATCGCTCCGGATCCGGCAGGG - Intergenic
1196287271 X:113897426-113897448 CCATCCCTCCGGATCCAGCAGGG - Intergenic
1196772518 X:119309111-119309133 CCATCCCTCCGGATCCAGCAGGG - Intergenic
1197252441 X:124229712-124229734 CCTTCCCTCTGCATCCCCCAAGG - Intronic
1197545319 X:127816559-127816581 CCATCCCTCCGGATCCGGCAGGG - Intergenic
1197746217 X:129933214-129933236 CCCTCACTCTGGGTCCGGCGAGG - Intergenic
1197999709 X:132420302-132420324 CCACCCCTCCAGATCCGGCAGGG - Intronic
1198566832 X:137913866-137913888 CCATCCCTCCAGATCCGGCAGGG - Intergenic
1199268778 X:145858460-145858482 CCATCCCTCCAGATACGGCAGGG - Intergenic
1199368816 X:147020948-147020970 CCATCCCTCCAGATCCGGCAGGG + Intergenic
1199432084 X:147773212-147773234 CCATTCTTCAGGATCCGGCAGGG + Intergenic
1200415974 Y:2910309-2910331 CCACCCCTCCAGATCCAGCAGGG - Intronic
1200500850 Y:3947148-3947170 CCATCTCTCTGGATCCGGCAGGG - Intergenic
1200762690 Y:7054629-7054651 CCATCCCTCCAGATCTGGCAGGG + Intronic
1200851257 Y:7886363-7886385 CCACCCCTCTGGATCCAGCAGGG - Intergenic
1201329238 Y:12800048-12800070 CCACCCCTCCAGATCTGGCAGGG + Intronic
1201421481 Y:13804589-13804611 CCACCCCTCCAGATCCAGCAGGG + Intergenic
1201642238 Y:16192156-16192178 CCACCCCTCCAGATCTGGCAGGG - Intergenic
1201660577 Y:16393165-16393187 CCACCCCTCCAGATCTGGCAGGG + Intergenic
1201723814 Y:17132992-17133014 CCAACCCTCTGAATCTGGCAGGG - Intergenic
1201905236 Y:19080361-19080383 CCATCCCTCTGGATCCAGCAGGG + Intergenic
1201962275 Y:19694668-19694690 CCACCCCTCCAGATCCAGCAGGG - Intergenic