ID: 1111536793

View in Genome Browser
Species Human (GRCh38)
Location 13:89612085-89612107
Sequence ACTGCTAACTTCCATCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111536793_1111536801 13 Left 1111536793 13:89612085-89612107 CCAGAGGGATGGAAGTTAGCAGT No data
Right 1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG No data
1111536793_1111536796 -10 Left 1111536793 13:89612085-89612107 CCAGAGGGATGGAAGTTAGCAGT No data
Right 1111536796 13:89612098-89612120 AGTTAGCAGTGGGTCTACAACGG No data
1111536793_1111536797 -7 Left 1111536793 13:89612085-89612107 CCAGAGGGATGGAAGTTAGCAGT No data
Right 1111536797 13:89612101-89612123 TAGCAGTGGGTCTACAACGGCGG No data
1111536793_1111536798 0 Left 1111536793 13:89612085-89612107 CCAGAGGGATGGAAGTTAGCAGT No data
Right 1111536798 13:89612108-89612130 GGGTCTACAACGGCGGCAAACGG No data
1111536793_1111536800 9 Left 1111536793 13:89612085-89612107 CCAGAGGGATGGAAGTTAGCAGT No data
Right 1111536800 13:89612117-89612139 ACGGCGGCAAACGGCAGTGGTGG No data
1111536793_1111536799 6 Left 1111536793 13:89612085-89612107 CCAGAGGGATGGAAGTTAGCAGT No data
Right 1111536799 13:89612114-89612136 ACAACGGCGGCAAACGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111536793 Original CRISPR ACTGCTAACTTCCATCCCTC TGG (reversed) Intergenic
No off target data available for this crispr