ID: 1111536801

View in Genome Browser
Species Human (GRCh38)
Location 13:89612121-89612143
Sequence CGGCAAACGGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111536791_1111536801 23 Left 1111536791 13:89612075-89612097 CCTGCCGGATCCAGAGGGATGGA No data
Right 1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG No data
1111536793_1111536801 13 Left 1111536793 13:89612085-89612107 CCAGAGGGATGGAAGTTAGCAGT No data
Right 1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG No data
1111536789_1111536801 24 Left 1111536789 13:89612074-89612096 CCCTGCCGGATCCAGAGGGATGG 0: 12
1: 63
2: 139
3: 135
4: 201
Right 1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG No data
1111536792_1111536801 19 Left 1111536792 13:89612079-89612101 CCGGATCCAGAGGGATGGAAGTT No data
Right 1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111536801 Original CRISPR CGGCAAACGGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr