ID: 1111540437

View in Genome Browser
Species Human (GRCh38)
Location 13:89661088-89661110
Sequence CTAGCATCCCAAATATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111540434_1111540437 13 Left 1111540434 13:89661052-89661074 CCTAGCTGGCTCTTGTTCCTACA No data
Right 1111540437 13:89661088-89661110 CTAGCATCCCAAATATTTGGAGG No data
1111540430_1111540437 28 Left 1111540430 13:89661037-89661059 CCAAGGGGCCCACTACCTAGCTG No data
Right 1111540437 13:89661088-89661110 CTAGCATCCCAAATATTTGGAGG No data
1111540432_1111540437 20 Left 1111540432 13:89661045-89661067 CCCACTACCTAGCTGGCTCTTGT No data
Right 1111540437 13:89661088-89661110 CTAGCATCCCAAATATTTGGAGG No data
1111540433_1111540437 19 Left 1111540433 13:89661046-89661068 CCACTACCTAGCTGGCTCTTGTT No data
Right 1111540437 13:89661088-89661110 CTAGCATCCCAAATATTTGGAGG No data
1111540435_1111540437 -4 Left 1111540435 13:89661069-89661091 CCTACACTTTGTTGAAAAACTAG No data
Right 1111540437 13:89661088-89661110 CTAGCATCCCAAATATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111540437 Original CRISPR CTAGCATCCCAAATATTTGG AGG Intergenic
No off target data available for this crispr