ID: 1111542629

View in Genome Browser
Species Human (GRCh38)
Location 13:89689047-89689069
Sequence CCCAGCACGAGGAGTTGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111542629_1111542635 19 Left 1111542629 13:89689047-89689069 CCTAGGCAACTCCTCGTGCTGGG No data
Right 1111542635 13:89689089-89689111 ACCAGAGTAGCATGTGATCTAGG No data
1111542629_1111542633 -4 Left 1111542629 13:89689047-89689069 CCTAGGCAACTCCTCGTGCTGGG No data
Right 1111542633 13:89689066-89689088 TGGGCTAGGCTCAGAGCCAGAGG 0: 2
1: 21
2: 102
3: 240
4: 676
1111542629_1111542637 20 Left 1111542629 13:89689047-89689069 CCTAGGCAACTCCTCGTGCTGGG No data
Right 1111542637 13:89689090-89689112 CCAGAGTAGCATGTGATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111542629 Original CRISPR CCCAGCACGAGGAGTTGCCT AGG (reversed) Intergenic
No off target data available for this crispr