ID: 1111542633

View in Genome Browser
Species Human (GRCh38)
Location 13:89689066-89689088
Sequence TGGGCTAGGCTCAGAGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1041
Summary {0: 2, 1: 21, 2: 102, 3: 240, 4: 676}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111542629_1111542633 -4 Left 1111542629 13:89689047-89689069 CCTAGGCAACTCCTCGTGCTGGG No data
Right 1111542633 13:89689066-89689088 TGGGCTAGGCTCAGAGCCAGAGG 0: 2
1: 21
2: 102
3: 240
4: 676

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111542633 Original CRISPR TGGGCTAGGCTCAGAGCCAG AGG Intergenic
900199424 1:1397222-1397244 TGGGCTAAGGTCAGAGGCAGCGG + Intronic
900611976 1:3548098-3548120 GGAGGCAGGCTCAGAGCCAGTGG + Intronic
900928266 1:5719542-5719564 TGGGCTATGCTCAGGGCTGGAGG + Intergenic
901027338 1:6285547-6285569 TGGTCCAGGCTCTGACCCAGTGG - Intronic
901234515 1:7660837-7660859 GGGGCCAGGCTCAGAGGCAGTGG - Intronic
902682195 1:18051240-18051262 TGGGCTGGAGTCAGACCCAGGGG - Intergenic
902977362 1:20098596-20098618 AGGCCTAGGCTCTGTGCCAGTGG - Intergenic
903667717 1:25018046-25018068 TGGGCTTCGCTCAGCTCCAGTGG + Intergenic
904260863 1:29286934-29286956 AAGGCCAGGCTCAGATCCAGGGG - Intronic
904261610 1:29290916-29290938 TGGGCTGGGAACAGAGCCTGTGG + Intronic
905004372 1:34698208-34698230 TGGGCCAGGCTGAGGGCCATCGG + Intergenic
906734746 1:48114925-48114947 TGAGCTGAGCTCAGAGCCAGTGG + Intergenic
907261559 1:53222181-53222203 TGTGCTGAGCTCAGAGCCCGTGG + Intergenic
907335664 1:53697872-53697894 GGAACTGGGCTCAGAGCCAGTGG + Intronic
907477449 1:54715133-54715155 GTGGCTAAGCTCAGAGACAGAGG + Intronic
908397661 1:63740968-63740990 TGTGCTGGGGTCAGAGCCAGTGG - Intergenic
908958988 1:69671537-69671559 TGAACTGGGCTCAGCGCCAGTGG - Intronic
909870397 1:80731399-80731421 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
910289693 1:85588280-85588302 TGAGCTGGGCTCAGAGCAGGTGG + Intergenic
910560187 1:88581891-88581913 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
911012558 1:93296790-93296812 TGTGCTGGGCTGGGAGCCAGTGG - Intergenic
911487090 1:98515867-98515889 TGAACTGGGCTTAGAGCCAGTGG + Intergenic
912015266 1:105026938-105026960 TGTGCTGGGCTTACAGCCAGTGG + Intergenic
912242572 1:107926906-107926928 TGAACTGGGCTCAGAGCCAGGGG + Intronic
912316347 1:108670532-108670554 TGGGCTGGGCTCTGAGCCAGTGG + Intergenic
912746313 1:112248405-112248427 GAGACTAGGCTCAGAGGCAGAGG - Intergenic
913147156 1:116003367-116003389 TGGGCTGGGCTCAGAGTCAGTGG - Intronic
913428217 1:118758547-118758569 TGGGCTAGGGGTAGAGCCTGTGG - Intergenic
913579803 1:120214823-120214845 TGGCCCAGGCTCAGAGCTTGTGG - Intergenic
913628371 1:120683565-120683587 TGGCCCAGGCTCAGAGCTTGTGG + Intergenic
914561736 1:148826249-148826271 TGGCCCAGGCTCAGAGCTTGTGG - Intronic
914611096 1:149303958-149303980 TGGCCCAGGCTCAGAGCTTGTGG + Intergenic
915005266 1:152629737-152629759 TCTGCTGGGCTCGGAGCCAGTGG + Intergenic
915172194 1:153985966-153985988 GGGGGAAGGGTCAGAGCCAGGGG + Intronic
916341904 1:163745673-163745695 TGGCCTGGCCTTAGAGCCAGTGG - Intergenic
916356668 1:163917399-163917421 TGGGATCAGCTCAGAGCCAGGGG - Intergenic
916360503 1:163962372-163962394 TGTGCTGGGCCCTGAGCCAGTGG + Intergenic
916572138 1:166037295-166037317 TGGGCCAGGCTCAGAAGGAGCGG - Intergenic
916993251 1:170267610-170267632 TGTGCTGGGCTTAGAACCAGTGG - Intergenic
917003450 1:170385982-170386004 TGAGCTAGGCCCAGAGACAGTGG - Intergenic
917191289 1:172422092-172422114 TGTGCTGGGCTCTGAGCCAGTGG + Intronic
917300642 1:173570583-173570605 TGTGCTGGTCTCAGAGCCAGTGG - Intronic
917306168 1:173627734-173627756 TGTGCAGGGATCAGAGCCAGTGG + Intronic
917373171 1:174317679-174317701 TGAACTAGGCCCAGAGACAGTGG - Intronic
917387353 1:174491617-174491639 TGGGCTGGTGTCAGAGCCAGTGG - Intronic
917977851 1:180251564-180251586 TGGACAAAGCGCAGAGCCAGGGG - Intronic
918106806 1:181422449-181422471 TGGTCTAGACCTAGAGCCAGTGG - Intronic
918357930 1:183723765-183723787 AGTGCTGGGCTCAGAGCCAGTGG + Intronic
918416314 1:184311583-184311605 TGAACTAGGCCCAGAGACAGTGG - Intergenic
918666299 1:187155029-187155051 TGAACTAGGCCCAGAGGCAGTGG - Intergenic
919067704 1:192714160-192714182 TATGCTGGGCTCAGAGCCAGTGG + Intergenic
919514990 1:198511452-198511474 TATGCTGGGCTCAGAGACAGTGG - Intergenic
919841213 1:201610736-201610758 TGGGCTAGGCTTGGAGTAAGAGG + Intergenic
920447512 1:206030007-206030029 TGTGCTAGGCTCTGAGCTAAGGG + Intergenic
920595015 1:207260029-207260051 TGAGCTGGGCTCAGAGCCCGTGG - Intergenic
921162531 1:212483305-212483327 TGGGCAGGGCTCAGGGCCACTGG + Intergenic
921238830 1:213155289-213155311 TGAACTAGGCCCAGAGACAGTGG - Intronic
921636797 1:217505108-217505130 ATGGCTAGGCTCAGAGACACAGG + Intronic
921929468 1:220743290-220743312 TGTGCTGGGCTCACAGCCAGTGG - Intergenic
922320561 1:224482779-224482801 TGTGCTGGGCTCAGAGCCAAAGG - Intronic
922388628 1:225114526-225114548 CGTGCTGGGCTCAGAGCCAGTGG - Intronic
922685241 1:227633830-227633852 TGAACTGGGCCCAGAGCCAGTGG + Intronic
923879090 1:238084009-238084031 TGAACTAGGCCCAGAGACAGTGG - Intergenic
923985739 1:239379843-239379865 TGGGACAGCCTCAGAGCTAGTGG - Intergenic
924377855 1:243431748-243431770 TGGACAAGCCCCAGAGCCAGTGG + Intronic
924490890 1:244536296-244536318 TGTACTGGGCTCAGAGACAGTGG - Intronic
924629176 1:245721127-245721149 TGAGCTGGGCTCGAAGCCAGTGG + Intergenic
924648809 1:245904701-245904723 TGAACTAGGCCCAGAGACAGTGG + Intronic
924768275 1:247054267-247054289 TGAGCTGGGCTCAGAGGCAGAGG + Intronic
924793371 1:247273175-247273197 TGAACTGGGCTCATAGCCAGTGG - Intergenic
1063517790 10:6713475-6713497 GGGGATGGGATCAGAGCCAGAGG - Intergenic
1064314768 10:14245196-14245218 TGGGCTGGGATCAGTGGCAGTGG + Intronic
1064987593 10:21226414-21226436 TGTGCTGGGCTCAGAGCCAATGG - Intergenic
1065467824 10:26044313-26044335 TGAACTGGGCTCAGAGCCAGTGG - Intronic
1065504676 10:26417590-26417612 AGGTCTAGGTTCAAAGCCAGAGG - Intergenic
1065921760 10:30399237-30399259 CATGCTAGGCTTAGAGCCAGTGG + Intergenic
1066649796 10:37643399-37643421 TGTGCTGGGCTCAGATCCAGTGG - Intergenic
1067032686 10:42888944-42888966 CGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1067324442 10:45253590-45253612 TGAGGTGGGCTCAGAGCCAGTGG + Intergenic
1067752525 10:48981543-48981565 TGGCCTGGACTCAGAGCCACTGG - Intronic
1068083463 10:52347221-52347243 TGGGCTGGCCTCTGAGGCAGGGG - Intergenic
1068104104 10:52592108-52592130 TGAGCTGGGCTCTGAACCAGTGG - Intergenic
1069050599 10:63788575-63788597 TTGGCTGGGCTCGGAGCCAGAGG + Intergenic
1069570114 10:69489687-69489709 TTGCCTGGGGTCAGAGCCAGGGG - Intronic
1070015703 10:72528105-72528127 TGGGCTAGGCCCAGAGGCTCAGG - Intronic
1070895389 10:79979751-79979773 CTAGCTGGGCTCAGAGCCAGTGG + Intronic
1071211641 10:83348484-83348506 TGAACTAGGCCCAGAGACAGTGG + Intergenic
1071522551 10:86340177-86340199 TGAGCAAGGATCAGAGCAAGGGG + Intronic
1071935600 10:90526794-90526816 TGTGCTGGGCTCTGAGCCAGTGG - Intergenic
1072058707 10:91787636-91787658 TGTGCTGGGCTTGGAGCCAGTGG + Intergenic
1072083526 10:92056692-92056714 TGAACTAGGCCCAGAGACAGTGG + Intronic
1072492455 10:95921051-95921073 TGTGCAGGGCTCACAGCCAGTGG - Intronic
1073708268 10:106011229-106011251 TGAACTGGGCTCAGAGTCAGTGG - Intergenic
1074361022 10:112824177-112824199 TGGCCCAGCCACAGAGCCAGGGG + Intergenic
1074408392 10:113201257-113201279 TAAGCTGGGCTCAGAGCCAGTGG + Intergenic
1074424579 10:113339596-113339618 TGTGCTAGGCTCTGAGCTAAGGG - Intergenic
1074507378 10:114083439-114083461 AGTGCTAGGCTCAGAGACACGGG - Intergenic
1074897808 10:117792270-117792292 TGGGCTAGGCACTGAGACACTGG + Intergenic
1075668261 10:124245797-124245819 TTGGCTGCTCTCAGAGCCAGAGG + Intergenic
1076203642 10:128577879-128577901 TGGGCTGGACACAGACCCAGTGG + Intergenic
1076376746 10:129993423-129993445 TGTGCTGGGTTCAGAGCCAGTGG + Intergenic
1076411019 10:130250842-130250864 TGGGCTAGGCCCAGAGGCCCCGG + Intergenic
1076824183 10:132959024-132959046 TGGGCAAGGCTCAGAGCAGCTGG - Intergenic
1077229753 11:1453481-1453503 TGGGGTAAGGTCAGGGCCAGTGG + Intronic
1077276754 11:1715077-1715099 TGGACTAAGCACAGAGCCAGGGG - Intergenic
1077427370 11:2489510-2489532 TGAGATGGGCTCAGAGCCAGTGG + Intronic
1077858793 11:6157073-6157095 TGTGGTGGGCTCAGAGCTAGTGG + Intergenic
1077911926 11:6579860-6579882 TGTGCTGGGCTTGGAGCCAGTGG + Intronic
1077970183 11:7181348-7181370 TGAACTAGGCTCAGAGACAGTGG + Intergenic
1078020665 11:7653847-7653869 AGGACTAGGCTCAGTGCCACCGG - Intronic
1078244675 11:9563369-9563391 TGTGTTGGGCCCAGAGCCAGTGG - Intergenic
1078348184 11:10570193-10570215 TGGGCTGGGCTCTTACCCAGAGG + Intronic
1078690810 11:13578974-13578996 TGTACTAGGCTTGGAGCCAGTGG + Intergenic
1078773647 11:14374363-14374385 TGTGCCAGGCACTGAGCCAGGGG - Intergenic
1078843153 11:15097459-15097481 TGGGCTGGACTCAGAGCCAATGG - Intergenic
1079516944 11:21280916-21280938 TGAACTGGACTCAGAGCCAGTGG + Intronic
1079532926 11:21477063-21477085 TTTGCTAGGCTCAGAGCAAGTGG + Intronic
1079571758 11:21952395-21952417 TGAACTGGGCCCAGAGCCAGTGG + Intergenic
1079622275 11:22568215-22568237 TGGGAGTGGCACAGAGCCAGGGG - Intergenic
1079801947 11:24879992-24880014 TGAGCTGGGCTCAGAGACGGTGG - Intronic
1079818578 11:25094659-25094681 TGGGCTAGGGTCAGGGTCAGGGG + Intergenic
1080489925 11:32751371-32751393 TGTACTGGTCTCAGAGCCAGTGG - Intronic
1081153710 11:39663799-39663821 GAGGCTAGGCTGACAGCCAGTGG - Intergenic
1081245685 11:40763919-40763941 TGTACTGGGCTCAGAGCCAGTGG + Intronic
1081343482 11:41955757-41955779 TGGGAGTGGCACAGAGCCAGGGG + Intergenic
1081594264 11:44448394-44448416 TGTGCTTGGCTCAGAGAGAGAGG + Intergenic
1081867917 11:46369766-46369788 TGGGGGAGGCTCAGACTCAGAGG - Intronic
1083488066 11:62995928-62995950 TGGTATAGGCTGTGAGCCAGGGG + Intronic
1083512857 11:63227685-63227707 TGGGCTGGGCTAAGAGCCAGTGG - Intronic
1083745757 11:64735684-64735706 TGAGCTAGGGCCAGAGGCAGGGG + Intronic
1083960400 11:66012063-66012085 AGGGCCAGGCCCAGCGCCAGCGG - Exonic
1084551811 11:69848206-69848228 TGTGCCAGGCTCTGTGCCAGGGG + Intergenic
1084857616 11:71999069-71999091 GGGGCTAGGATGAGAGACAGAGG + Exonic
1085175949 11:74488364-74488386 TGTGCCAGGCCCTGAGCCAGGGG + Intergenic
1085562703 11:77486908-77486930 TGTTCCAGGATCAGAGCCAGTGG + Intergenic
1086033025 11:82383480-82383502 AGTGCTGGGCTCAGAGTCAGTGG + Intergenic
1086838293 11:91653284-91653306 TGAGCTGGGCTCAGAGCCAGTGG - Intergenic
1087095190 11:94311446-94311468 TCTGCTAGGCTCAGAGGCTGTGG + Intergenic
1087299221 11:96413217-96413239 TGTGCTGGGCTCAGAGTCCGTGG + Intronic
1087345290 11:96964443-96964465 TGTGCTAGTCTCAGAACCAGTGG + Intergenic
1087370623 11:97279512-97279534 TAGGTTGGGCTTAGAGCCAGTGG + Intergenic
1087417218 11:97872104-97872126 TGGTCTGGACTAAGAGCCAGTGG - Intergenic
1088181746 11:107121024-107121046 TGTGGTGGGCTCAGAGCCAGTGG + Intergenic
1088335513 11:108699353-108699375 TGTGATAGACTGAGAGCCAGAGG - Intronic
1088375873 11:109141014-109141036 TAAACTGGGCTCAGAGCCAGTGG - Intergenic
1088386804 11:109267563-109267585 AGGGCTGGGCTTAGAGTCAGAGG + Intergenic
1088718075 11:112566343-112566365 TGTGCAGGGCACAGAGCCAGGGG - Intergenic
1088938300 11:114426491-114426513 TGAGCTGGGCTCAGAGCCAGTGG - Intronic
1088985113 11:114899068-114899090 TGAACTGGGCTCAGTGCCAGTGG + Intergenic
1089762278 11:120736457-120736479 TGTGCTGGGCTTAGAGCCAGTGG - Intronic
1090756663 11:129797871-129797893 TGGGGTAAGCTCACAGCCTGGGG + Intergenic
1090975718 11:131678334-131678356 TGGGCACTGCCCAGAGCCAGAGG - Intronic
1091051152 11:132373874-132373896 TGTGCTGGACTCAGAACCAGTGG + Intergenic
1092183294 12:6460954-6460976 TGGGCCAGGGCCAGAGCCAAGGG - Intronic
1092291002 12:7159372-7159394 TAGCCAAGGCTCAGACCCAGGGG + Intergenic
1092497554 12:9012081-9012103 TATGCTAGGCTCAGAGCCAGTGG + Intergenic
1092637807 12:10469958-10469980 TGGGATAGGTACAGAGCCAAGGG - Intergenic
1092729077 12:11511389-11511411 TGGGGTAGACACAGTGCCAGTGG - Intergenic
1093387330 12:18573897-18573919 TAGGCTATTCTCAGAGCCACTGG - Intronic
1093619921 12:21277002-21277024 TGAGCTGGGCTCAGAGCCAATGG + Intronic
1093694424 12:22143973-22143995 TGTGCTGGGCTCAGAGCTAGGGG + Intronic
1093903412 12:24661760-24661782 TGTTCTGGGCTCAGAGCCAGTGG - Intergenic
1093931665 12:24960594-24960616 TGTGCTGGGCTCAGAGCTAGTGG + Intergenic
1093991015 12:25590509-25590531 TGGACTGGTCCCAGAGCCAGTGG + Intronic
1094650279 12:32369461-32369483 TGGTCAGGGGTCAGAGCCAGGGG + Intronic
1094655955 12:32419604-32419626 TAAGCTGGGCCCAGAGCCAGTGG - Intronic
1094658275 12:32441694-32441716 TGAACTAGGCCCAGAGACAGTGG - Intronic
1095163247 12:38941301-38941323 TGTGCTGGGCTTAGAGCCAGTGG + Intergenic
1095860182 12:46908044-46908066 TGTGCTAGGTTCAGAGCCAGTGG + Intergenic
1095939532 12:47717076-47717098 AGGGGTGGCCTCAGAGCCAGAGG + Intronic
1097046135 12:56189146-56189168 GGGGCTGGGCTCAGAGGCTGGGG + Intronic
1097508550 12:60507182-60507204 TGGGCTGGGCTCAGAACCAGTGG + Intergenic
1097563701 12:61240198-61240220 TGAACTAGGCTTAGAGACAGTGG - Intergenic
1097714920 12:62955671-62955693 TGAGCTGGTCTCAGAGCCAGTGG - Intergenic
1097791260 12:63817923-63817945 TGAACTAGGCCCAGAGACAGTGG + Intergenic
1098142994 12:67469656-67469678 TGAACTAGGCCCAGAGGCAGTGG - Intergenic
1098405616 12:70123171-70123193 TGGGCTGGGCTCAGAGTCAGTGG + Intergenic
1098959058 12:76719394-76719416 TGTGCTGGGCTTGGAGCCAGCGG + Intergenic
1099548525 12:84014019-84014041 TGTGCTGGGCTCGGAGCCAGTGG - Intergenic
1099574347 12:84361952-84361974 ATGGCCAGGCTCAGGGCCAGCGG + Intergenic
1099616068 12:84937812-84937834 TGGGTTGGGCTCAGAGCTAGTGG + Intergenic
1099757756 12:86876571-86876593 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1099764226 12:86961352-86961374 TTGGCTGGGCTTAGAGCCAGTGG - Intergenic
1099807866 12:87543078-87543100 TGTTCTGGGCTTAGAGCCAGTGG + Intergenic
1099882168 12:88480147-88480169 TGTGCTGGGCTCCAAGCCAGTGG + Intergenic
1100061089 12:90576152-90576174 TTTGCTGAGCTCAGAGCCAGTGG - Intergenic
1101252065 12:102946297-102946319 TATGCTGGGCTCAGAGCCAGTGG - Intronic
1102018332 12:109663497-109663519 TGGTCTATGCTCAGAGCCTAGGG - Intergenic
1102266601 12:111491380-111491402 TGTGCTGGGCTCATAGTCAGTGG + Intronic
1104159673 12:126166119-126166141 TGGGCTAGGACAAGAGGCAGAGG - Intergenic
1105559122 13:21473786-21473808 TGTGCTGGGCTTAGAGCCAGTGG - Intergenic
1106074694 13:26448172-26448194 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1106350178 13:28922360-28922382 TGAGCTGGATTCAGAGCCAGTGG - Intronic
1107178032 13:37422694-37422716 TGTCCTGGGCTCAGAGCCAGTGG + Intergenic
1107210790 13:37852089-37852111 TAGGCTGGACTCAGAACCAGAGG + Intronic
1107370240 13:39737690-39737712 TGTGCTGGGCTTAGAGCCAGTGG - Intronic
1108137868 13:47385292-47385314 TGAAGTTGGCTCAGAGCCAGTGG + Intergenic
1108879121 13:55087366-55087388 TGTGCTAGGCTCAGAGCAAAAGG - Intergenic
1108962210 13:56247926-56247948 TGGGCTTGGCTTAGAGTCAGTGG - Intergenic
1108972968 13:56400885-56400907 TGTGCTGGGCTCAGGGCCAGTGG + Intergenic
1109308147 13:60662985-60663007 TGGGATTGGCTCAGAGCCAAGGG + Intergenic
1109402943 13:61858442-61858464 TGTGCTGTGCTCAGAGCCAGTGG - Intergenic
1109685768 13:65818384-65818406 TGAACTGGGCTCAGAGCCAGTGG + Intergenic
1110901433 13:80830619-80830641 TAAGCTGGGCTCAGAGCCAGTGG + Intergenic
1110974112 13:81807996-81808018 TGAATTGGGCTCAGAGCCAGAGG + Intergenic
1111076979 13:83249336-83249358 TGTGCTGGGCTGAGAGCCAGTGG - Intergenic
1111291869 13:86182181-86182203 TATGCTGGGCTCAGAGCTAGTGG + Intergenic
1111513305 13:89294368-89294390 TGAACTGGGCCCAGAGCCAGTGG - Intergenic
1111542633 13:89689066-89689088 TGGGCTAGGCTCAGAGCCAGAGG + Intergenic
1111568645 13:90048754-90048776 TGTGCTAGTCTCATAGGCAGTGG - Intergenic
1112053889 13:95671788-95671810 TGTGCTGGGCTTAGAGCCAATGG - Intergenic
1112657991 13:101473614-101473636 TGTGCTGGGCTTGGAGCCAGTGG + Intronic
1113244396 13:108377989-108378011 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1113253867 13:108485916-108485938 TAGGCTAGAGTTAGAGCCAGTGG + Intergenic
1114244989 14:20904767-20904789 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1114247995 14:20932939-20932961 TGTGCTGAGCTCAGAGCCAGTGG + Intergenic
1114250830 14:20959038-20959060 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1114985216 14:28217937-28217959 TGAACTTGGCCCAGAGCCAGAGG - Intergenic
1115133860 14:30086075-30086097 TGAGCTGGGCTTAGAGCCAGCGG + Intronic
1115204175 14:30884111-30884133 CGGGCTTGGCTCAGAGCCTCGGG - Intronic
1115282468 14:31678825-31678847 TGAGCTGTGCTCAGAGCCAGTGG - Intronic
1115620385 14:35134818-35134840 TGAACTGGGCTCAGAGCCAGTGG - Intronic
1116079332 14:40153879-40153901 TGAGCTGGGCCCAGAGCCAGTGG + Intergenic
1116106383 14:40513559-40513581 TGTGCTTGGCTAAGAGCCAGTGG + Intergenic
1116192518 14:41679214-41679236 TGTGCTGGGCTCAAAGCCAATGG + Intronic
1116354733 14:43914277-43914299 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1116410872 14:44622005-44622027 GGGACTAGGCACAGAGACAGAGG + Intergenic
1116480984 14:45391603-45391625 TGAACTGGGCTGAGAGCCAGTGG + Intergenic
1116677786 14:47927355-47927377 TGTGCTGGTCTTAGAGCCAGTGG - Intergenic
1116930833 14:50688886-50688908 TGAACTAGGCCCAGAGACAGTGG - Intergenic
1117161521 14:52994727-52994749 TGTGCTAGGCTCAGAGCCAGTGG - Intergenic
1117208535 14:53470558-53470580 TGTGCTGGGCTATGAGCCAGTGG - Intergenic
1117418278 14:55518541-55518563 TGGGTTGGGCTTAGAGCCAGTGG + Intergenic
1117438181 14:55737483-55737505 TGGTCTAGGCTGAGAGCCTCAGG - Intergenic
1117483220 14:56169233-56169255 TGAGCTAGGCCCAGAGACCGTGG - Intronic
1117504508 14:56388842-56388864 TATGCTGGGCTCAGAGCCACTGG - Intergenic
1117607066 14:57440713-57440735 TGTAGTGGGCTCAGAGCCAGCGG - Intergenic
1118034252 14:61849356-61849378 TGTGCTGGGCTCAGAACCAGTGG - Intergenic
1118241247 14:64060683-64060705 TGTGCTACAATCAGAGCCAGTGG - Intronic
1118458485 14:65966552-65966574 TGGGACCGGCACAGAGCCAGTGG - Intronic
1118956559 14:70488483-70488505 TGAACTAGGCCCAGAGTCAGTGG + Intergenic
1119087799 14:71753333-71753355 AAGACTGGGCTCAGAGCCAGGGG + Intergenic
1120697363 14:87659313-87659335 TGGGCTGGGCTTAAAACCAGTGG + Intergenic
1121449070 14:93996401-93996423 GGGGCTGGGCTCAGGGGCAGGGG - Intergenic
1121455238 14:94034611-94034633 TGTGCTAGGCTCAGGGAGAGAGG - Intronic
1121759841 14:96435573-96435595 TGAGCGAGGCCCAGAGACAGTGG - Intronic
1122839364 14:104447981-104448003 AGGGCTCAGCCCAGAGCCAGTGG + Intergenic
1123040272 14:105487524-105487546 ACGGGGAGGCTCAGAGCCAGAGG - Intronic
1123502503 15:20902721-20902743 TGAACTGGGCTTAGAGCCAGTGG + Intergenic
1123559752 15:21476388-21476410 TGAACTGGGCTTAGAGCCAGTGG + Intergenic
1123595987 15:21913687-21913709 TGAACTGGGCTTAGAGCCAGTGG + Intergenic
1123935324 15:25191272-25191294 GGGGCTGAGCCCAGAGCCAGTGG - Intergenic
1124444249 15:29715013-29715035 TGAGCTAGGCACTGAGCCATAGG - Intronic
1125277081 15:38004416-38004438 GGTGCTTGGCTCAGAGCCAGTGG - Intergenic
1125567244 15:40685978-40686000 CATGCTAGGCTCAGAGCCAGCGG - Intergenic
1125878292 15:43168751-43168773 TATGTTGGGCTCAGAGCCAGTGG - Intronic
1126015602 15:44347663-44347685 AGTGCTGGGATCAGAGCCAGTGG + Intronic
1126183694 15:45810597-45810619 TGATCTAGGCCCAGAGGCAGTGG + Intergenic
1126216173 15:46157451-46157473 TGTACTAGGCTCAGAAACAGTGG + Intergenic
1126534074 15:49741878-49741900 TGAGCTGGGCTCAGAGCCAGTGG + Intergenic
1126572254 15:50164638-50164660 TGTCCTGGGCTTAGAGCCAGTGG - Intronic
1126979917 15:54228892-54228914 TGTGCTATGCTTAGAGCCAGTGG - Intronic
1127170821 15:56299493-56299515 TGTTCTAGGCTCAGAGCCAGTGG + Intronic
1127178102 15:56382924-56382946 TGGGCTTGACTCAGAGCCAGAGG - Intronic
1127829318 15:62736683-62736705 TTGGTTTGGCCCAGAGCCAGGGG + Intronic
1128355496 15:66923621-66923643 TGGGCTAGGCGCAGAGGATGGGG + Intergenic
1128417315 15:67458613-67458635 TTGGCTAGGTACAGAGCCAAGGG - Intronic
1128786229 15:70399514-70399536 AGGGCAAGGCTCAAAGACAGGGG + Intergenic
1129030703 15:72615740-72615762 CATGCTGGGCTCAGAGCCAGTGG - Intergenic
1129477547 15:75796263-75796285 CATGCTGGGCTCAGAGCCAGTGG - Intergenic
1129500973 15:76037649-76037671 TGAGCTGGGCTTGGAGCCAGTGG + Intronic
1129835612 15:78703540-78703562 CATGCTGGGCTCAGAGCCAGTGG - Intronic
1130511719 15:84595096-84595118 CATGCTGGGCTCAGAGCCAGTGG + Intergenic
1130885004 15:88085312-88085334 TGGGCCAAGCCCAGAGTCAGTGG - Intronic
1130961645 15:88663472-88663494 TGTGCTGGGCTTGGAGCCAGTGG + Intergenic
1131944836 15:97608662-97608684 TGTGCTGGGCTCAGGGCCAGTGG + Intergenic
1132316890 15:100896959-100896981 TGGGCTCGGGGCAGAGCCGGAGG + Intronic
1202968094 15_KI270727v1_random:203550-203572 TGAACTGGGCTTAGAGCCAGTGG + Intergenic
1132469988 16:97157-97179 TGGGCGTGGCCCAGAGCCACGGG - Intronic
1132763060 16:1520340-1520362 TGGCCTAGGCAGAGAGACAGCGG + Exonic
1133221688 16:4321652-4321674 TGGGGTGGGCTCCGTGCCAGGGG + Intronic
1133268844 16:4600581-4600603 TGGGCCAGGCTCAGGGCCCTGGG - Exonic
1134278010 16:12793628-12793650 TGGACTAGACACAGAGCAAGTGG + Intronic
1135488149 16:22884042-22884064 TGGGCAAGTCACAGAGACAGAGG + Intronic
1135510476 16:23078554-23078576 TGGGCAGAGATCAGAGCCAGAGG - Intronic
1136096896 16:27963295-27963317 TGGGCTTGGGTCAGAGACACTGG - Intronic
1136389256 16:29952013-29952035 TGGGCTGGCCTTAGAGCCAGTGG - Intronic
1136679153 16:31945317-31945339 TGGGTTGGTCTTAGAGCCAGTGG + Intergenic
1138548739 16:57735724-57735746 TGGGCGGGGCTCTGAGCCGGAGG + Exonic
1138845017 16:60554713-60554735 TGGGCTGGGCTCAGAGCCAGAGG - Intergenic
1139103898 16:63802493-63802515 TGAACTAGGCTCAGGACCAGTGG - Intergenic
1139122910 16:64042508-64042530 TGAGCTGGGCTCAGAGCCAGTGG + Intergenic
1139312493 16:66039534-66039556 TGCCCTGTGCTCAGAGCCAGGGG + Intergenic
1139649552 16:68355510-68355532 AGAGCGAGGCTCAGAGCCAGCGG + Intronic
1140158215 16:72455829-72455851 TGAACTGGGCCCAGAGCCAGCGG - Intergenic
1141344289 16:83231016-83231038 TGGGCGAAGGTCAGAGCCCGAGG - Intronic
1141485051 16:84333437-84333459 TGGGCTGGGCTTAGAGCCAGAGG + Intergenic
1141772326 16:86096990-86097012 TGAGGTAGGCTGAGAACCAGGGG + Intergenic
1142380251 16:89727939-89727961 GGCGCTTGGCTCAGAGGCAGGGG - Intronic
1142919173 17:3169600-3169622 TGTGCTGGGCTCAGAGATAGTGG + Intergenic
1144945008 17:18965320-18965342 TGGGCAAGGCTCAGGGGCAGAGG + Intronic
1145845006 17:28030997-28031019 TGGGCTGGTCTCAGAGCATGGGG - Intergenic
1146098923 17:29959867-29959889 TGTACTGGGCTCAAAGCCAGTGG - Intronic
1146242640 17:31244348-31244370 TGTGCTGGGCTCAGAGCCAGTGG - Intronic
1146419744 17:32672100-32672122 TGTGCTGGGCTCTGTGCCAGGGG + Intronic
1146473029 17:33139590-33139612 AGAGCAAGGCTGAGAGCCAGGGG - Intronic
1146691344 17:34878213-34878235 TGGGCTGGGCACAGAACCATTGG + Intergenic
1146977814 17:37130723-37130745 TGGGTGAGGCTGAGACCCAGAGG + Intronic
1147032095 17:37646947-37646969 TAAGCTAGGCTCATAGGCAGTGG + Intergenic
1148104897 17:45113851-45113873 CAGGCTTGGGTCAGAGCCAGGGG + Intronic
1148644820 17:49213664-49213686 TGGGCTAAGAGCAAAGCCAGGGG + Intronic
1148667012 17:49382558-49382580 TGGGCCAGGCCCAGGGGCAGAGG - Intronic
1149157435 17:53648303-53648325 TGACCTAGGCCCAGAGACAGTGG - Intergenic
1149180697 17:53932583-53932605 TGTGCTGGGCTTAGAGCCAGTGG - Intergenic
1149188471 17:54030217-54030239 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1149234818 17:54577770-54577792 TGAACTAGGCCCAGAGACAGTGG + Intergenic
1149569605 17:57663146-57663168 GGGGCTTTGCTCTGAGCCAGTGG + Intronic
1150526752 17:65931737-65931759 TGGGCTTGCCTCTGAGCCTGGGG - Intronic
1150531740 17:65990742-65990764 TGAGCTGGGCTCAGAGCCAGTGG + Intronic
1150541420 17:66104093-66104115 TGTGCTGAGCTCAAAGCCAGTGG + Intronic
1151597513 17:75087619-75087641 TGGGGAAGGCGCAGAGCCCGAGG - Intergenic
1152393392 17:80016585-80016607 TTGGCTAGGCTCTGGGACAGAGG + Intronic
1153356673 18:4144144-4144166 TGTGCTGGACTCGGAGCCAGTGG - Intronic
1153715139 18:7839728-7839750 TGAACTGGGCCCAGAGCCAGTGG - Intronic
1154230494 18:12552250-12552272 TGAGCTGGGCTCAGAGCCAGTGG + Intronic
1154344620 18:13531799-13531821 TGTGCTGGCCTCAGAGACAGTGG + Intronic
1154386498 18:13897474-13897496 TGAACTAGGCCCAGAGACAGCGG + Intronic
1154407418 18:14107061-14107083 TGAACTGGGCTTAGAGCCAGTGG + Intronic
1155281999 18:24249868-24249890 TGGGCTGGGCTGACAGCCAGAGG + Intronic
1155533708 18:26794436-26794458 TGAACTGGGCTCAGGGCCAGTGG + Intergenic
1156021636 18:32606272-32606294 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1156155747 18:34300291-34300313 TGAGCTGAGCTCAGAGCCAGTGG + Intergenic
1156391276 18:36652716-36652738 TGGGGTGGCCTCAGACCCAGAGG - Exonic
1156473534 18:37391982-37392004 TGTGCAAGGCTGAGAACCAGAGG + Intronic
1157623812 18:49031872-49031894 TGGCCTTGGCTCAGAGCTGGGGG + Intergenic
1159092108 18:63861038-63861060 TGTGCTGGGCTCAGAACCAGTGG - Intergenic
1159564888 18:70037233-70037255 TAGGCTGGGCTTAGAGCCACTGG + Intronic
1159775419 18:72598591-72598613 TGAACTGGGCTCAAAGCCAGTGG - Intronic
1160151733 18:76400219-76400241 TGGCCTAGGCTCAGACCTGGGGG - Intronic
1160573141 18:79832089-79832111 CGGAGTAGGCTCAGAACCAGGGG - Intergenic
1161056566 19:2193609-2193631 CGTGCTAGGCTCGGAGACAGAGG - Intronic
1161144841 19:2671350-2671372 AGGTCGAGGCTCAGAGCCACCGG - Intronic
1161455901 19:4369618-4369640 GGGGCCAGGGCCAGAGCCAGAGG - Intronic
1161479463 19:4503376-4503398 TGGGCTAGCCTGAGAGCACGGGG + Exonic
1161726872 19:5934308-5934330 TGGGCAAGGCACAGAGACTGTGG + Intronic
1162595340 19:11624700-11624722 TGGGCTGCTCACAGAGCCAGAGG + Intergenic
1162693104 19:12449972-12449994 TGAGCTGGGCTCAGAGCCAGTGG - Intronic
1162740828 19:12772694-12772716 TGGGGGAGGCTGAGACCCAGGGG + Intronic
1163242122 19:16070663-16070685 TGAGCTAGGCTCCGGGCCAAGGG - Intronic
1163418335 19:17200525-17200547 AGCCCTAGGCACAGAGCCAGGGG + Intronic
1163728050 19:18933475-18933497 TTGTCTACCCTCAGAGCCAGTGG - Intronic
1165645317 19:37431155-37431177 TGTGCTGGGCTTGGAGCCAGTGG + Intronic
1166408420 19:42540183-42540205 TAGGCTGGGCTTAAAGCCAGTGG - Intronic
1168337584 19:55605305-55605327 TGGGCGTGGTTCAGGGCCAGGGG + Intergenic
1168448997 19:56448442-56448464 TGTGCTTGGCTCAGAACCAGTGG + Intronic
1168554145 19:57323924-57323946 AGTGCTACGCTCAGAGCCAATGG - Intronic
1168615518 19:57834054-57834076 TGAGCTGGGCTCCGAGCCAGGGG - Intronic
1168621267 19:57881393-57881415 TGAGCTGGGCTCCGAGCCAGGGG + Intronic
925269353 2:2591301-2591323 TAAGCTGGGCTCAGAGCCAGAGG + Intergenic
925416503 2:3673466-3673488 TGGGCTGGAGTCAGAGCCTGGGG + Intronic
925431849 2:3801650-3801672 TGTGCTGGGCTCCGGGCCAGGGG - Intronic
925506405 2:4569629-4569651 TGTGCTAGGCTTGGAACCAGTGG - Intergenic
925648426 2:6062444-6062466 TGGTCTAGGCTCAAAACAAGAGG - Intergenic
926088701 2:10036284-10036306 TGTGCTCAGCTCTGAGCCAGAGG + Intergenic
926128711 2:10286980-10287002 CGGGCCAGGCTGTGAGCCAGGGG - Intergenic
926511948 2:13792199-13792221 TGAGCTAGGCTCAAGGCCAAGGG - Intergenic
926812925 2:16772504-16772526 TGGGAGGGGCTCAGAGCAAGGGG - Intergenic
928293480 2:30060874-30060896 TCTGCTGGGCTCAGAGCCAGTGG + Intergenic
928495708 2:31829462-31829484 TAGCCCAGGCTTAGAGCCAGTGG - Intergenic
928715612 2:34056429-34056451 TATGCTCGGCTCAGAGCCAGTGG - Intergenic
928781752 2:34831077-34831099 TGACCTGGGCTCAGAGACAGAGG - Intergenic
929001807 2:37354192-37354214 TAGGCTAGCCTGAGAGGCAGAGG - Intronic
929099914 2:38301790-38301812 TGGGCTGGGCTCAGAGCCAGTGG + Intronic
929281801 2:40087954-40087976 TGAGCTGGACTCAAAGCCAGTGG - Intergenic
929525133 2:42694292-42694314 TGGGCTGGACTCAGAGCCAGAGG - Intronic
930041597 2:47129320-47129342 TCTGCTGGGCTCAGAGGCAGTGG - Intronic
930230756 2:48841597-48841619 TGTGCTGGGCTTGGAGCCAGTGG - Intergenic
930288002 2:49457908-49457930 TGACTTAGGCTCAGAGCCAGAGG - Intergenic
930439742 2:51390956-51390978 TGGACTGGGCTCAGAGCCACTGG - Intergenic
930469195 2:51792108-51792130 TATGCTGGGCTTAGAGCCAGTGG + Intergenic
930727264 2:54694500-54694522 TGAACTGGGCCCAGAGCCAGTGG + Intergenic
930805660 2:55486707-55486729 TGGGCTAGGCTCACTGCAACAGG - Intergenic
930878371 2:56245106-56245128 TGTGCTGGGCTCACAGCCAGTGG - Intronic
931086029 2:58831447-58831469 TGAACAGGGCTCAGAGCCAGTGG - Intergenic
931406985 2:61988698-61988720 TGTGCTAGGATCAGAGCCAGCGG - Intronic
931582937 2:63796805-63796827 TGTGCTGGGCTTGGAGCCAGTGG + Intronic
931736441 2:65199001-65199023 TGTGCTGGGCTTAGAGCCAGTGG + Intergenic
932517488 2:72368006-72368028 TGGGCTGGGCTCAGAGCCAGAGG + Intronic
932593131 2:73079141-73079163 TGGGGAAGGCAGAGAGCCAGAGG - Intronic
932889411 2:75579247-75579269 TGTGCTGGGCCCAGAGCCAGTGG + Intergenic
932921236 2:75917166-75917188 TGAGCTAGGCTTAGAGACAGAGG - Intergenic
933341715 2:81034172-81034194 TGGGGTAGGCCTGGAGCCAGTGG - Intergenic
933446553 2:82387286-82387308 TGGGCTGGGCTCAGAGCCAGAGG + Intergenic
934928904 2:98404307-98404329 TGTGCTGGACTCGGAGCCAGTGG + Intergenic
935812867 2:106817178-106817200 TGTGCTGGGCTCAGAGCCAGTGG + Intronic
936160162 2:110078941-110078963 AGTGCTGGGCCCAGAGCCAGGGG + Intergenic
936184502 2:110292413-110292435 AGTGCTGGGCCCAGAGCCAGGGG - Intergenic
936511365 2:113150139-113150161 TGTTCTGGGCTCAGAGTCAGTGG - Intergenic
936795353 2:116196553-116196575 TGAACTAGGCCCAGAGACAGCGG - Intergenic
936831477 2:116653395-116653417 TGAACTGAGCTCAGAGCCAGGGG + Intergenic
936901419 2:117485525-117485547 TGTGCTGGATTCAGAGCCAGTGG - Intergenic
937193993 2:120133717-120133739 TGTGCTGGGCTCAGAGCCAGTGG + Intronic
937378738 2:121356428-121356450 TTAGCTAGGCTCAGTACCAGAGG + Intronic
937739403 2:125332882-125332904 TGTGCTGGGCTCAGAATCAGTGG + Intergenic
938216920 2:129525976-129525998 TGAACTAGGCCCAGAGCCAGTGG + Intergenic
938388341 2:130883629-130883651 TGGCCCAGTCACAGAGCCAGGGG + Intronic
939275690 2:139993315-139993337 TGGGATTGGTGCAGAGCCAGTGG - Intergenic
939405150 2:141746181-141746203 TGAGCTGGGCTTGGAGCCAGTGG - Intronic
939707986 2:145478913-145478935 GGGGCTAGGCTCAGAGCCAATGG - Intergenic
939710364 2:145509608-145509630 TGAACTGGGCCCAGAGCCAGAGG - Intergenic
940402634 2:153265212-153265234 TGTGCTGGGCTCAGAGCCCATGG - Intergenic
940461451 2:153968115-153968137 TAGGCTGGTCTCAGAGGCAGTGG - Intronic
940559887 2:155281695-155281717 TGTGTGGGGCTCAGAGCCAGTGG - Intergenic
940629502 2:156219922-156219944 TGGGTTGGGCTCAGAGCCAGTGG + Intergenic
940795290 2:158071139-158071161 TGGGCTAGGATTAGAGCCAGTGG + Intronic
940802919 2:158153395-158153417 TGTGCTGGGCTGAGAACCAGTGG + Intergenic
941047604 2:160694485-160694507 TGGGCTAGGCTTAGAGCCAGTGG - Intergenic
941508356 2:166375848-166375870 TGGGCTAGCCTGGGTGCCAGTGG - Exonic
941851888 2:170191366-170191388 TGTGCTGGGCTCAAAGCCAGTGG - Intronic
942681400 2:178480795-178480817 TGGGGTAGGCGCAGGGCCTGGGG - Exonic
943208290 2:184928544-184928566 TGAACTGGGCTCAGAGCCAGTGG - Intronic
944526789 2:200627612-200627634 TGGGGTAGGCCAAGAGCCAATGG + Intronic
944616504 2:201465639-201465661 TGTGCTGGGCTTGGAGCCAGTGG - Intronic
944760287 2:202807576-202807598 TGTGCTGGGCTTGGAGCCAGTGG + Intronic
944954987 2:204798497-204798519 TGTGCTGGGTTCAGAGTCAGTGG + Intronic
945551673 2:211228703-211228725 TGTGCTGGACTCAGAGCTAGTGG + Intergenic
945711803 2:213306487-213306509 TATGCTGGGCTCAGAGCCAGTGG - Intronic
945803813 2:214465654-214465676 TGAGCTGGGCTCTGAGCCAGTGG - Intronic
946299196 2:218812245-218812267 TGCGCCAGGCTCTGAACCAGCGG + Exonic
946372063 2:219286838-219286860 TGGGCTGAGCTCAGATCCAGGGG + Exonic
946697245 2:222372167-222372189 TGAACTGGGCTCAGAGCTAGTGG + Intergenic
946862741 2:224015323-224015345 TGGGCCAGGGTGAGAGGCAGTGG + Intronic
947009244 2:225547353-225547375 TGTCCTGGGCTCAAAGCCAGTGG - Intronic
947039378 2:225897967-225897989 TAGGCTGGGCTTAGAGCCAGTGG + Intergenic
947130988 2:226924551-226924573 TGTGCTGGGCTCAGAGCCAGTGG - Intronic
947439814 2:230109495-230109517 CGGGCTGGGCTCAGAGCCATAGG - Intergenic
947642586 2:231715273-231715295 TGTGCTAGGCTCAGGACTAGGGG - Intergenic
947841455 2:233210427-233210449 AGGGCCAGGCGCCGAGCCAGGGG - Intronic
948361550 2:237424496-237424518 TGAGCCAGGCCCAGAGCAAGAGG + Intronic
948475583 2:238216867-238216889 TGTGCTGGGCTGAGAGCCAGTGG - Intergenic
948910703 2:241001069-241001091 TGGACAAGGGCCAGAGCCAGGGG - Intronic
1169648802 20:7843793-7843815 TAGGCTGGGATCAGGGCCAGGGG - Intergenic
1169910920 20:10646866-10646888 TGGGCCAGGGGCAGAGGCAGGGG + Intronic
1169988652 20:11474502-11474524 TGTGCTGTGCTCAGAGCCAGTGG + Intergenic
1170062692 20:12276122-12276144 TGCGATGAGCTCAGAGCCAGTGG + Intergenic
1170087031 20:12544997-12545019 TGAACTAGGCCCAGAGACAGCGG - Intergenic
1170311451 20:14997004-14997026 TGTGCTGAGCTCACAGCCAGTGG + Intronic
1170709331 20:18775861-18775883 TGTGCTAGGCTTGGAGTCAGTGG - Intergenic
1170796057 20:19547712-19547734 TGAGCTGGGCTCAGGGCAAGGGG - Intronic
1171819729 20:29823719-29823741 CGAGCTGGGCTCAGAGCCAGTGG - Intergenic
1171898088 20:30829460-30829482 TGAGCTGGACTCAGAGACAGTGG + Intergenic
1171942829 20:31348189-31348211 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1172596561 20:36154613-36154635 TGGGCTGGGCTCCGAGGCCGGGG + Intronic
1173004261 20:39127453-39127475 TGAACTGGGCCCAGAGCCAGTGG - Intergenic
1173204302 20:40980483-40980505 TGAGCTGGGCTCAGAGTCAGTGG - Intergenic
1173838175 20:46139211-46139233 GGGGCTGGCCTCAGAGCCAAAGG + Intergenic
1174544846 20:51317602-51317624 GGGGCCTGGCTCAGAGTCAGGGG + Intergenic
1175094663 20:56531914-56531936 TGGGCCAGGCACAGGGGCAGGGG - Intergenic
1175424071 20:58853378-58853400 TGGGCTAGGCCCAGCACCGGGGG - Exonic
1175857397 20:62129608-62129630 TGGGCTAGCCTCAGAGGGAATGG + Intronic
1176124101 20:63467487-63467509 TGGGCTAGCCTCAGCCCCATAGG - Intronic
1176243184 20:64084360-64084382 TGGGCAAAGCTCAGAGGCTGGGG - Intronic
1176892412 21:14333652-14333674 TGGGCTTAGCTCAGAGACAATGG + Intergenic
1176914484 21:14608537-14608559 TGTGCTGGGCTCAAAGCCAGTGG + Intronic
1176994934 21:15544218-15544240 TGTGCTGGCCTAAGAGCCAGTGG + Intergenic
1177105109 21:16945754-16945776 TATGCTGGGCACAGAGCCAGTGG + Intergenic
1177222297 21:18210025-18210047 TGTGCGGGGCTCAGAGCCAGTGG - Intronic
1177569729 21:22871406-22871428 TGAACTAGGCCCAGAGACAGTGG - Intergenic
1177592149 21:23184947-23184969 TGCGCTGGGCTTGGAGCCAGTGG + Intergenic
1177692740 21:24532157-24532179 TGTGCTGGGCTTGGAGCCAGTGG + Intergenic
1177849765 21:26332732-26332754 TGTGCTGGACTCGGAGCCAGTGG + Intergenic
1177969935 21:27777337-27777359 TGAGTTGGGCTCAGAGCCAGTGG + Intergenic
1178347990 21:31848622-31848644 TGGCCAAGGATGAGAGCCAGAGG - Intergenic
1179582703 21:42353486-42353508 TGGCATAGGCACAGAGACAGTGG - Intergenic
1179652420 21:42820308-42820330 TGTGCTAAGCTCAGATCCAGTGG + Intergenic
1179911135 21:44449578-44449600 TGGGACAGGCTGGGAGCCAGGGG + Intergenic
1180323731 22:11348410-11348432 CGAGCTGGGCTCAGAGCCAGTGG - Intergenic
1181633715 22:24164663-24164685 TGGTCCAGGCTCCCAGCCAGTGG - Intronic
1181695110 22:24589055-24589077 TGGGCTAGGCGCAGAGTCCTAGG + Intronic
1182775722 22:32829683-32829705 TGGGCCAGGGTCAGTGCCCGGGG - Intronic
1182941390 22:34280730-34280752 TGGGCTATACTCAGAGCCACTGG + Intergenic
1183945819 22:41325172-41325194 GGGGCTAGGTCCAGGGCCAGAGG + Intronic
1184421321 22:44384443-44384465 TGGGCTAGAGGAAGAGCCAGGGG + Intergenic
1184688561 22:46107332-46107354 CGGGCTTGGCTCAGGGCCACTGG - Intronic
1184870323 22:47233682-47233704 TGGGCCAGCCCCAGAGCCACAGG + Intergenic
1184897947 22:47423084-47423106 GCGGCAAAGCTCAGAGCCAGTGG - Intergenic
949235777 3:1806615-1806637 TGACCTGGGCTCAGAGCCAGGGG - Intergenic
949448613 3:4162347-4162369 TGTGCTGGGCTCAGAGCCAGTGG - Intronic
950477628 3:13223961-13223983 GGAGCCAGGCTCTGAGCCAGGGG + Intergenic
950695730 3:14699793-14699815 TGAGCTGGGCTCAGAGCCAGTGG - Intronic
951029363 3:17863862-17863884 TGTGCTAGGCTTGGAGTCAGTGG - Intronic
951125922 3:18983122-18983144 TGCACTGGGCTCAGAGCCAGTGG - Intergenic
951181851 3:19668487-19668509 TGAGCTGGGCTCAAAGCCAGTGG + Intergenic
951379684 3:21968372-21968394 TGTGCTGTGTTCAGAGCCAGTGG + Intronic
951708196 3:25565147-25565169 TGGGGTAGACTCAGACGCAGCGG + Intronic
952066520 3:29577446-29577468 TGGACTGGGCTCAGAGCCAGAGG - Intronic
952132889 3:30384952-30384974 TGTGCTAGGCTCAGAGCCAGTGG - Intergenic
952517977 3:34124870-34124892 TGTGCTGGGCTCAGAGACAGTGG - Intergenic
952672957 3:35993445-35993467 TGGGCTGAGGTCAGAACCAGTGG + Intergenic
952725681 3:36582093-36582115 TGTGCTGGGCTCAGACCCAGTGG + Intergenic
953217161 3:40930411-40930433 TGAGCTGGGCTCAGAGCCAGTGG + Intergenic
953834955 3:46334345-46334367 TGGGCTGCCCACAGAGCCAGAGG - Intergenic
954147444 3:48641328-48641350 TGGGCCGGGCCCAGCGCCAGAGG - Exonic
954370771 3:50168638-50168660 AGGATTAGGCTGAGAGCCAGGGG + Intronic
954459319 3:50617421-50617443 TGGGCTGGGCTGCGAGCCCGGGG - Intronic
954491801 3:50913492-50913514 TGAACTGGGCCCAGAGCCAGTGG - Intronic
954689152 3:52386619-52386641 TGGGGAAGACTCAGACCCAGTGG - Intronic
954724588 3:52596866-52596888 TGTGCTGGGCTCAGAGCCAGTGG - Intronic
954749670 3:52806417-52806439 TGGGCTAGGGCCGGGGCCAGGGG + Intronic
955274457 3:57533896-57533918 TGAGCTGAGCTCAGATCCAGTGG - Intronic
956549416 3:70441626-70441648 TTGGCTTAGCTCAGAGCAAGTGG + Intergenic
957087206 3:75692236-75692258 CTAGCTGGGCTCAGAGCCAGTGG + Intergenic
957538061 3:81531755-81531777 TGTACTGGGCTTAGAGCCAGTGG - Intronic
958083343 3:88774763-88774785 TGTGCTAGACTGAGAGACAGTGG + Intergenic
958147043 3:89639543-89639565 TGTGCCAGGCCTAGAGCCAGCGG + Intergenic
958428363 3:94006905-94006927 TGTGCTAAGCTCAGTGCTAGGGG + Intronic
958760087 3:98296486-98296508 TGTGTTAGGCTAAGAGCCAGTGG + Intergenic
958765405 3:98361244-98361266 TGAACTTGGCTCAGAGGCAGTGG - Intergenic
959126021 3:102291059-102291081 GGTGCTGGGCTCAGAGCTAGTGG - Intronic
959127445 3:102307522-102307544 TGTGCTGGGCCCAGAGTCAGTGG + Intronic
959215691 3:103447897-103447919 TAAGCTGAGCTCAGAGCCAGTGG + Intergenic
959448361 3:106467796-106467818 TGTGCTGGGGTCAGAGGCAGTGG - Intergenic
959640204 3:108623676-108623698 TGTGCTGGGCTTGGAGCCAGTGG - Intronic
959716810 3:109442699-109442721 TGCGCTGGGCTTGGAGCCAGTGG + Intergenic
959841677 3:110983827-110983849 TGTGCTGGGTTCAGAGCCAGTGG + Intergenic
960067232 3:113387147-113387169 TGTACTGGGCTCAGAGCCAGTGG + Intronic
960153604 3:114275517-114275539 TGTGCTGGACTCAGAGTCAGTGG - Intergenic
960207388 3:114918902-114918924 TCTGCTAGGCTTGGAGCCAGTGG - Intronic
960404062 3:117238314-117238336 TGTGCCGGGCTCAGAGCCAGTGG + Intergenic
960471908 3:118076110-118076132 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
960564845 3:119122510-119122532 TAAGCTGGGCTCAGAGCCAGTGG + Intronic
960840964 3:121958184-121958206 TGTGTTGGGCTCAGAGCCAGTGG + Intergenic
960862878 3:122169234-122169256 TGTGTTAGGCTCAGAGCCAGTGG - Intergenic
961359960 3:126360780-126360802 TTGCCAATGCTCAGAGCCAGGGG - Intergenic
961964504 3:130888358-130888380 TGGGATGGGCTTAGAGCCACTGG - Intronic
962106455 3:132395579-132395601 TGAACTAGGCCCAGAGACAGTGG + Intergenic
962151850 3:132902186-132902208 TGAACTAGGCCCAGAGACAGTGG + Intergenic
962455936 3:135565661-135565683 TGGGCACGGTGCAGAGCCAGGGG - Intergenic
962483252 3:135816082-135816104 TGTGCTGAGCTCAGAGCCAGTGG + Intergenic
962638873 3:137362041-137362063 TGTGGTGGGCTCAGAGCCAGCGG - Intergenic
962870928 3:139492223-139492245 TGGGCTGGGCTTGGAGCCGGTGG - Intergenic
963020553 3:140869201-140869223 TGTGCTAGGCTCAGAACCACTGG - Intergenic
963035155 3:141019479-141019501 TGGGCTTGGCTCCGAGGGAGAGG - Intergenic
963154050 3:142077289-142077311 TGTGCTGGGCTCAGAGCCAGTGG + Intronic
963310007 3:143699794-143699816 TGAACTGGGCTCAGAGCCAGTGG + Intronic
963443645 3:145374171-145374193 TGAGCTGGGCTCAGAGCCAGTGG + Intergenic
963676168 3:148314844-148314866 TATGCTGGGCTCGGAGCCAGTGG + Intergenic
963692197 3:148518942-148518964 TGAACTAGGCCCAGAGACAGTGG + Intergenic
963736177 3:149019907-149019929 TGGGATACGGACAGAGCCAGAGG + Intronic
964151592 3:153532001-153532023 TTTGCTGGGCTCAGAGCCAGTGG + Intergenic
964179260 3:153864551-153864573 TGAGCTTGGCTCAGAGACAGTGG + Intergenic
964179321 3:153864973-153864995 TGGGCTGGGCTTAGAGACAGGGG + Intergenic
964398518 3:156273254-156273276 TATGCTGTGCTCAGAGCCAGTGG - Intronic
964570334 3:158103389-158103411 TGCGGTAGGCAGAGAGCCAGCGG - Intronic
964804010 3:160587285-160587307 CAAGCTGGGCTCAGAGCCAGTGG + Intergenic
964992212 3:162828260-162828282 TGAGCTAGTCTCAGAGCCTGTGG + Intergenic
965253091 3:166368304-166368326 TGAACAGGGCTCAGAGCCAGTGG + Intergenic
965264092 3:166518450-166518472 TGGGCTAGGCGCAGAGCCAGTGG + Intergenic
965317276 3:167208272-167208294 TGTGTTAAGCTCACAGCCAGTGG + Intergenic
965415261 3:168384871-168384893 TGGGCTGGGCTTAGAACCAGTGG - Intergenic
965502031 3:169468502-169468524 TGAGCTAGGCTCTGAGGCACGGG - Intronic
965849671 3:173009318-173009340 TGGGATTGGTGCAGAGCCAGAGG + Intronic
965867101 3:173217335-173217357 TGTGCTGGGCTTTGAGCCAGTGG - Intergenic
966454066 3:180094795-180094817 TGTGCTGGGCTCTGAGCCAGTGG - Intergenic
966463461 3:180203279-180203301 TGTACTGGGCTCAAAGCCAGTGG + Intergenic
966895163 3:184439455-184439477 TGGGCCATACACAGAGCCAGGGG - Exonic
967096710 3:186183194-186183216 TGGGCTAGGCTAGGAGTCATGGG + Intronic
968005088 3:195237127-195237149 TGTGCTGGGCTCAGAGCCAGTGG - Intronic
968017948 3:195356442-195356464 TGGGCTGGGCTCAGAGCCAGTGG + Intronic
968218499 3:196915197-196915219 TGTGCTGGGGTCAGAGCCTGTGG + Intronic
968472114 4:786980-787002 TGGGCTGGGTTTGGAGCCAGAGG - Intronic
968576864 4:1370698-1370720 TGGACTTGGCTCATAGCCACAGG + Intronic
968810686 4:2798463-2798485 GAGACCAGGCTCAGAGCCAGAGG + Intronic
969071468 4:4542477-4542499 TGTGCAAGGCACAGAGCTAGAGG + Intergenic
969461834 4:7333148-7333170 TGGGGTGGGGTCAGAGGCAGAGG - Intronic
969533843 4:7743952-7743974 TGGGCTGGGCTCTGGGCCTGGGG + Intergenic
970071279 4:12162492-12162514 TCAGCTGGGCTCAGAGACAGTGG - Intergenic
970311065 4:14783076-14783098 TGAGTCAGCCTCAGAGCCAGGGG - Intergenic
970667557 4:18354612-18354634 TGAACTAGGCCCAGAGACAGTGG - Intergenic
972125365 4:35758672-35758694 TGTGCTGGGCTTGGAGCCAGTGG - Intergenic
972237525 4:37150965-37150987 TGAACTAGGCCCAGAGACAGTGG - Intergenic
972271157 4:37511740-37511762 TGAGCTGGGCTCTGAGCCAGTGG - Intronic
972278528 4:37581778-37581800 TGTGCTGGGGCCAGAGCCAGTGG - Intronic
972909479 4:43797165-43797187 TGAACTAGGCCCAGAGACAGTGG + Intergenic
972928368 4:44040324-44040346 TGGGCTGGACTCAAAGCCAGAGG + Intergenic
973030696 4:45333762-45333784 TGGGCTAAAGTCAGAGTCAGAGG - Intergenic
973053841 4:45629951-45629973 TGAGCTAGGCTTGGAGCCAGTGG + Intergenic
973169433 4:47120995-47121017 TGTCCTGGGCTCAGAGCCAGTGG - Intronic
973227382 4:47801861-47801883 TGAGCTGGGTTCAGAGCCGGTGG + Intronic
973287905 4:48440184-48440206 TGGACTGGGCTTGGAGCCAGTGG - Intergenic
973348475 4:49082507-49082529 TGTGCTGGTCTCAGAGCCAGTGG + Intergenic
973763171 4:54139527-54139549 TGAGCTGGGCTCAGAGCCAGTGG + Intronic
974290258 4:59920870-59920892 TGAACTAAGCCCAGAGCCAGTGG + Intergenic
974292215 4:59947745-59947767 TGTGCTGGACTCAGAGCCAGTGG + Intergenic
974299048 4:60041092-60041114 TGGGCTGGGCTCAGAGTCAATGG - Intergenic
974333091 4:60505220-60505242 TGAGCTGGGCTCTAAGCCAGTGG + Intergenic
974589122 4:63920248-63920270 TCTGCTGGGCTCAGAGCCAGTGG - Intergenic
974630413 4:64480678-64480700 TGAACTAGGCCCAGAGACAGTGG - Intergenic
974771726 4:66423375-66423397 TGTGCTGGGCTCAGACCCAGTGG + Intergenic
974868029 4:67603907-67603929 TGTGCTGGGCTTGGAGCCAGTGG - Intronic
975040152 4:69736308-69736330 TGAGATGGCCTCAGAGCCAGTGG + Intronic
975095723 4:70454182-70454204 TGTGTTGGGCTCAGACCCAGTGG - Intronic
975369566 4:73568778-73568800 TGTGCTGGGGTCAGAGGCAGTGG - Intergenic
975503819 4:75116841-75116863 TGAGCTGGGCTCAGAGCCAGTGG + Intergenic
976082897 4:81375764-81375786 TGTGCTGGGCTCAAAGACAGTGG - Intergenic
976453927 4:85223718-85223740 TTAGCTGGTCTCAGAGCCAGAGG - Intergenic
976574927 4:86657981-86658003 TGCACTAGTCTCAGAGGCAGTGG - Intronic
976762849 4:88569001-88569023 TGTGGTGGGCTCAGAACCAGTGG - Intronic
977026870 4:91830890-91830912 TGAACTGGGCCCAGAGCCAGAGG - Intergenic
977074297 4:92433285-92433307 TGTGCTGGGCCCAGAGCCAGTGG - Intronic
977107446 4:92906409-92906431 TGAGCTGAGCTCAGAGCCAAAGG + Intronic
977341486 4:95764029-95764051 TGTGCTAGGCTTATAGTCAGTGG + Intergenic
977399086 4:96509466-96509488 TGAGCTAGGCTGAAAGACAGTGG + Intergenic
978116403 4:105024765-105024787 TGAGCTAGACTCAGAGACAATGG + Intergenic
978180487 4:105789356-105789378 TGTGAGAGGCTCTGAGCCAGAGG - Intronic
978287731 4:107098581-107098603 TGAGCTAGCCTCAGAGCCAGCGG + Intronic
978654291 4:111048472-111048494 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
978676773 4:111327529-111327551 TGAACTAGGCCCAGAGACAGTGG - Intergenic
979184561 4:117772333-117772355 TGTGCTGGGCTCAGAACCAGTGG + Intergenic
979565153 4:122146198-122146220 TGTGCTACACTCAGAGCCAGTGG - Intergenic
979945760 4:126829802-126829824 TGTGCTGGGCTCAGAGGCAGTGG + Intergenic
980226838 4:129998281-129998303 TGTGCTGGGCTCAGAATCAGTGG + Intergenic
980686747 4:136239779-136239801 TGAACTAGGCCCAGAGACAGAGG + Intergenic
980752947 4:137116024-137116046 TGGGCTGGGCTTAGAGCTAGTGG + Intergenic
981045290 4:140259121-140259143 TGGGCAAGGCTCAGAAACAGAGG + Intronic
981140162 4:141258944-141258966 TGTGCTGGGCTCAGAGTCAGTGG + Intergenic
981392790 4:144211421-144211443 TGGGCTGGGGTCAGAACCACAGG - Intergenic
981664380 4:147206588-147206610 TAGGCTTGGCTCAAAGACAGAGG - Intergenic
982622695 4:157727343-157727365 TGTGCTGGGCTCACAGCCAGTGG + Intergenic
982719673 4:158847210-158847232 TGTGCTGGGCTCAGAGCCAGTGG + Intronic
982899594 4:160981332-160981354 TGGGCTAGGCTAAGAGCCAGTGG - Intergenic
982911490 4:161148324-161148346 TGTGCTGGGCTTGGAGCCAGTGG + Intergenic
983388845 4:167102824-167102846 AGTCCTAGGCTCAGAGACAGGGG + Intronic
983493048 4:168411701-168411723 TGTGCTGGGCTCAGAGCCTATGG + Intronic
984296026 4:177855664-177855686 GGGCCAATGCTCAGAGCCAGAGG - Intronic
984310668 4:178053795-178053817 TGTGCTGGACTCTGAGCCAGTGG - Intergenic
984529846 4:180902478-180902500 TGGACTAGGCTTAAAGCCAGTGG - Intergenic
984915518 4:184719601-184719623 TGAGCTGGGCTTGGAGCCAGTGG + Intronic
985536916 5:470281-470303 GGGGCTGTGCTCAGATCCAGGGG + Intronic
985638019 5:1049395-1049417 TGGGCCAGGCACAGAGGCAGGGG - Intergenic
986046569 5:4044004-4044026 TGAGCTGGGCTCAGAGCCGGTGG + Intergenic
986756239 5:10839329-10839351 TGTGCTGGGCTCAAAGCCAGTGG + Intergenic
987023769 5:13902368-13902390 TGGGCCAGACACAGAGCCTGGGG + Intronic
987405375 5:17518956-17518978 TGTTCTAGGCCCAGGGCCAGAGG + Intergenic
987407430 5:17585147-17585169 TGTTCTAGGCCCAGGGCCAGAGG - Intergenic
987408576 5:17593783-17593805 TGTTCTAGGCCCAGGGCCAGAGG - Intergenic
987409032 5:17597217-17597239 TGTTCTAGGCCCAGGGCCAGAGG - Intergenic
987496647 5:18653348-18653370 TGAACTAGGCTCAGAGCCAGTGG - Intergenic
987564217 5:19564186-19564208 TGTGCTGGGCTTGGAGCCAGTGG + Intronic
987772898 5:22329962-22329984 TAGGCTGGGCTTAGAGCCAGTGG + Intronic
987903807 5:24050291-24050313 TGTGCTGAGCTTAGAGCCAGTGG + Intronic
988117759 5:26919529-26919551 CTTGCTCGGCTCAGAGCCAGTGG + Intronic
988384117 5:30539408-30539430 TGTGCTGGGCCCAGAGCCAGAGG + Intergenic
988608604 5:32703893-32703915 TGTGCTAGGCGTGGAGCCAGTGG - Intronic
989330005 5:40245908-40245930 TGAGCTAGACTCAAAGCCAGTGG + Intergenic
989628896 5:43460930-43460952 TGAACTAGGCCCAGAGACAGTGG + Intronic
989690919 5:44143034-44143056 TGTGCAGGGCTCAGAGCCAGTGG - Intergenic
990214356 5:53514065-53514087 TGAGCTGGGCTCATAGTCAGTGG - Intergenic
990231040 5:53712944-53712966 TGGGAGAGGCACAGAGCCAGGGG - Intergenic
990579126 5:57151235-57151257 TGCGCTGGGCCCAGATCCAGTGG - Intergenic
990923868 5:60996570-60996592 TGAACTAGGCTCAGCGACAGTGG - Intronic
991018762 5:61958641-61958663 TGAACTAGGCCCAGAGACAGTGG - Intergenic
991237608 5:64417769-64417791 TGAACTGGACTCAGAGCCAGTGG + Intergenic
991297111 5:65093194-65093216 TGAGCTGGGTTGAGAGCCAGTGG + Intergenic
991408001 5:66320362-66320384 TGGGATAGGGTATGAGCCAGTGG - Intergenic
993014568 5:82520916-82520938 TGTGCTAGGCTCTTGGCCAGTGG - Intergenic
993138289 5:83998094-83998116 TGTGCTAGGCTGGGAGCCCGTGG + Intronic
993171108 5:84419902-84419924 TGAACTGGGCTTAGAGCCAGTGG - Intergenic
993267508 5:85744757-85744779 TGGATTGGGCTCAGAGCCAGAGG - Intergenic
993279298 5:85905014-85905036 TGGGCTGGGCTCAGAGTCATAGG + Intergenic
993840852 5:92876677-92876699 TGGGCTCAGCTCAGAGTCAGTGG - Intergenic
993981186 5:94545317-94545339 TGTGCTGGGCTTAGAACCAGTGG + Intronic
994274780 5:97822541-97822563 TGGGCTGGGCTCAGAGCCAGAGG - Intergenic
994343722 5:98661694-98661716 TGAGATCGGTTCAGAGCCAGTGG + Intergenic
994343801 5:98662388-98662410 TGGCCTGGGCTTAGAGACAGTGG + Intergenic
994881156 5:105498281-105498303 TGTGCTGGGCTCAGAACCAGTGG - Intergenic
994974036 5:106779599-106779621 TGTGCTGGACTCAGAGCCAATGG + Intergenic
995049615 5:107687766-107687788 TGTGTTGGGCTCAGAGCCAGTGG + Intergenic
995258388 5:110073193-110073215 TGGGAGTGGCACAGAGCCAGGGG - Intergenic
995310727 5:110707620-110707642 TGGGTTGGACTCAGAGCCAGTGG + Intronic
995485234 5:112633575-112633597 TGAGCCAGCCTCAGAGCCACAGG + Intergenic
995573239 5:113503360-113503382 TGACCTGGGCTCACAGCCAGTGG - Intergenic
995687274 5:114784475-114784497 TGGACTGTGTTCAGAGCCAGTGG - Intergenic
995770536 5:115664821-115664843 TGAACTGGGCTCAGAGACAGTGG + Intergenic
996166473 5:120229556-120229578 TGGGCTGGGCTAACAGCCAAAGG - Intergenic
996192627 5:120564288-120564310 TGGGCTGGGCTCAGAGGCAGGGG - Intronic
996259234 5:121445683-121445705 TGGGCCGGGCTTAGAGCCAGTGG + Intergenic
996653675 5:125913725-125913747 TGTGCTAGGCTCAGAGCCAGAGG - Intergenic
996659825 5:125988708-125988730 TATGCTGGACTCAGAGCCAGTGG - Intergenic
996666499 5:126066204-126066226 TGGGCTGAGCTAAAAGCCAGTGG + Intergenic
996931714 5:128896700-128896722 TGAGCTGGTCTCAGAGCCAGTGG - Intronic
996961579 5:129256072-129256094 TGAACCAGACTCAGAGCCAGTGG - Intergenic
997186135 5:131884122-131884144 TGAACTGGGCTCAGAGCCAGTGG + Intronic
997408371 5:133670410-133670432 TGGGCAAGGCCAAGAGCCCGGGG + Intergenic
997626891 5:135337157-135337179 TGGGCTGGGCTGAGGGCCTGTGG + Intronic
997978285 5:138453156-138453178 TGGGCCAGGCTCACGGGCAGTGG - Intergenic
998291275 5:140916826-140916848 TGGGCTGGGCTCAGAACCAGAGG - Intronic
998376865 5:141696757-141696779 TGGGCTGGGCTGAGAGGCAGAGG - Intergenic
998689448 5:144571118-144571140 TGTGCTGGGCTCAGATCCAGTGG - Intergenic
999667349 5:153927023-153927045 TGAGCTGAGCTCAGAGCTAGTGG + Intergenic
999668640 5:153938722-153938744 TAGGAAAGGCTCAGAGCCTGGGG + Intergenic
999849563 5:155523644-155523666 TGAACTAAGCCCAGAGCCAGTGG - Intergenic
1001189070 5:169609921-169609943 TGAGCAGGACTCAGAGCCAGTGG + Intergenic
1001845305 5:174916723-174916745 CATGCTGGGCTCAGAGCCAGTGG + Intergenic
1002009918 5:176270936-176270958 TGTGTTGGGCTCAGAGCCAGTGG + Intronic
1002603545 5:180369013-180369035 CAGGCTAGACTCAGAGTCAGGGG - Intergenic
1004339450 6:14795407-14795429 CAGGGTAAGCTCAGAGCCAGAGG + Intergenic
1005037487 6:21570091-21570113 TGTGCTGGGCTCTGAGCCAGTGG - Intergenic
1006511414 6:34523535-34523557 TGAGCTAGCCTCACAGCCACTGG + Intronic
1006716431 6:36123621-36123643 TGGGCCAGGCACAGTGCCAGGGG + Intergenic
1006794256 6:36721918-36721940 CAGTCTTGGCTCAGAGCCAGTGG - Exonic
1007021783 6:38528385-38528407 TGTGCTGGGCTCGAAGCCAGTGG + Intronic
1007190429 6:40011905-40011927 TGTGCTGGGCTCAGAACCAGTGG - Intergenic
1007834686 6:44665409-44665431 TGGGCTGGGCTAAGGGCAAGTGG + Intergenic
1008017766 6:46541121-46541143 TGAACCAGGCCCAGAGCCAGTGG + Intergenic
1008177697 6:48288649-48288671 TGAACTAGGCTGAGAGACAGTGG - Intergenic
1008214963 6:48777770-48777792 TGAACTAGGCCCAGAGACAGTGG + Intergenic
1008642096 6:53474570-53474592 TATGATAGGCTCAGAGCCAGTGG - Intergenic
1009308924 6:62125456-62125478 TATGTTGGGCTCAGAGCCAGTGG + Intronic
1009353493 6:62709992-62710014 TAAGCTGGGCTCAGAGCCAGTGG - Intergenic
1009371092 6:62904842-62904864 TGGGCTTGGCTCAGAGCCAAAGG + Intergenic
1009373597 6:62939108-62939130 TGGATTGGGCTTAGAGCCAGTGG - Intergenic
1009375343 6:62961445-62961467 TGGGCTGGATTCAGAGCCAGTGG - Intergenic
1009728109 6:67560299-67560321 TTGGCTAGACTCAGAGTCAGTGG - Intergenic
1009748238 6:67847962-67847984 TGAGCTAGGCTCAGAGCCAGTGG + Intergenic
1009781708 6:68279946-68279968 TGGGCTGGGCTCAGAGCCAGTGG + Intergenic
1009847422 6:69151144-69151166 TGTGCTGGGCTTGGAGCCAGTGG - Intronic
1009932237 6:70190079-70190101 TGGGCTGGGATCATAACCAGTGG - Intronic
1010018677 6:71135057-71135079 TGTGCTGGGTTCAGAGCCAGTGG + Intergenic
1010434533 6:75814041-75814063 TATGATAGGCTCAGAGCCACCGG - Intronic
1010775318 6:79878566-79878588 TGGGCTGGGCTTAGAGCCAGAGG + Intergenic
1011018889 6:82788868-82788890 TATGCTTGGATCAGAGCCAGTGG + Intergenic
1011340921 6:86313478-86313500 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1011791924 6:90907755-90907777 TGGGTCAGGCTCAGAGCCACAGG - Intergenic
1012003550 6:93684576-93684598 TGGGTTGGGCTCAGAGCCAGAGG + Intergenic
1012027022 6:94008637-94008659 TAGGCTAGGCTCAGAAACAGAGG + Intergenic
1012028550 6:94029239-94029261 TGGGCTGGGCTTAGAGCCAGTGG + Intergenic
1012047750 6:94300622-94300644 TGTGCCAGGCTCAGAGCCAGTGG + Intergenic
1012057091 6:94426899-94426921 TGTGTTAGGATCAGAGCCAATGG - Intergenic
1012059731 6:94463154-94463176 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1012125054 6:95418596-95418618 TTGGCTATGCTGAGATCCAGTGG + Intergenic
1012190708 6:96276642-96276664 TGTGCTGGGCTTGGAGCCAGTGG + Intergenic
1012715238 6:102660648-102660670 TGCGCTGGGCTCAGATGCAGTGG + Intergenic
1012827262 6:104162439-104162461 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1012827574 6:104165039-104165061 TGAGCTAGGCCCAGAGACATTGG + Intergenic
1013403040 6:109817231-109817253 AGGGCTTGGCTCTGAGCCACAGG - Intronic
1014074005 6:117215897-117215919 TGTGCAGGGCTCAGAGCCAGTGG - Intergenic
1014234545 6:118939860-118939882 AGAGCTGGGCTCAGAGCCATTGG + Intergenic
1014430564 6:121365646-121365668 TACGTTGGGCTCAGAGCCAGTGG + Intergenic
1014692361 6:124577667-124577689 TGTGCTTCGCTCACAGCCAGTGG + Intronic
1014794637 6:125710574-125710596 TGTGCTGGGCTTTGAGCCAGTGG + Intergenic
1015572541 6:134636389-134636411 TGGTCTGGGCTTAAAGCCAGAGG + Intergenic
1015578895 6:134702207-134702229 TGTGCTGGGCTCAAAGCAAGTGG - Intergenic
1015907211 6:138129545-138129567 TACGCTGGGCTCGGAGCCAGTGG + Intergenic
1015959353 6:138631320-138631342 TGGACTAGGCCCAGAGCCAGAGG + Intronic
1016153908 6:140780417-140780439 TGAACTGGGCTCAGAGCCAGGGG + Intergenic
1016185843 6:141196716-141196738 TGAACTAGGCTGAGAGACAGTGG - Intergenic
1016228554 6:141772514-141772536 TGAGCTGGTCTCAGAGCCAGTGG - Intergenic
1016229716 6:141788529-141788551 TCTGCTGGGCTCAAAGCCAGTGG + Intergenic
1016643901 6:146381161-146381183 TGAACTAGGCCCAGAGACAGTGG - Intronic
1016813510 6:148282909-148282931 TGAGCTATGCTTAGAACCAGTGG - Intronic
1017042938 6:150322444-150322466 TGGGCTGGGCTTAGACCCTGGGG + Intergenic
1017379580 6:153813287-153813309 TGAACTAGGCCCAGAGACAGTGG + Intergenic
1017495269 6:154978137-154978159 AGTGCTAGACTAAGAGCCAGAGG + Intronic
1019044316 6:169131570-169131592 AAGGCTGGGCTTAGAGCCAGTGG + Intergenic
1019066340 6:169302470-169302492 TGTGCTGAGCTCAGAGGCAGTGG + Intergenic
1020058880 7:5137406-5137428 TGGGCTGGGCTTTTAGCCAGAGG - Intergenic
1021057543 7:16068397-16068419 CAGGCAAGGCTTAGAGCCAGGGG - Intergenic
1021842585 7:24732877-24732899 TGTGCTGGGCTCAGAGCCAGTGG + Intronic
1022223665 7:28340671-28340693 TGTGCTGGGCTCAGAGCCAGTGG - Intronic
1022749954 7:33214019-33214041 TAAGCTGGGTTCAGAGCCAGAGG - Intronic
1022969916 7:35507503-35507525 GGGGCCGAGCTCAGAGCCAGAGG - Intergenic
1023143739 7:37128802-37128824 TGTGCTAGGCTCTGTGCCAGGGG + Intronic
1023799828 7:43824208-43824230 TGGGCTGCCCACAGAGCCAGAGG - Intergenic
1024299255 7:47874125-47874147 GGGGCCAGGCTCCGAGCCACAGG + Intronic
1026133383 7:67638431-67638453 TGTGCAGGGCCCAGAGCCAGAGG - Intergenic
1027201405 7:76066083-76066105 AGTGCGAGGCTCAGAGCCAGAGG - Intronic
1027405474 7:77855515-77855537 TGTGCTGGGCTCAGAGCCAGTGG - Intronic
1027996054 7:85426795-85426817 TGTGCTGGGCTGAAAGCCAGAGG + Intergenic
1028160844 7:87483386-87483408 TAAGCTGAGCTCAGAGCCAGTGG + Intergenic
1028307896 7:89289819-89289841 TGAGCTGAGCTCAGAGCCAGTGG + Intronic
1028354393 7:89888089-89888111 TGGGCTGGGCTCAGAGCCAGAGG - Intergenic
1028868134 7:95736817-95736839 TGGGCTGGGCTCAAAGCCAGAGG - Intergenic
1028929626 7:96398164-96398186 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1029306664 7:99624728-99624750 TGACCTGGGCTCAGAGCCTGGGG + Intronic
1029736329 7:102467836-102467858 TGGGCTGGCCTCAGAGCCCTGGG - Intronic
1030246355 7:107387971-107387993 TGGGCCAGGCAGAGAGCCATGGG - Intronic
1030391363 7:108931956-108931978 TGTGCTGGGCTTGGAGCCAGTGG - Intergenic
1030662663 7:112238514-112238536 TGTGCTGGGCTTGGAGCCAGTGG + Intronic
1030665469 7:112273099-112273121 TGTGCTAGGCTCAGAGCCAGCGG - Intronic
1030939724 7:115631022-115631044 TGGGGGAGACTTAGAGCCAGCGG + Intergenic
1031243829 7:119281385-119281407 TGGGCTTGGCTCAGAGTGAGTGG - Intergenic
1031272201 7:119665980-119666002 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1031288420 7:119901274-119901296 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1031306183 7:120130586-120130608 TCTGCTGGGTTCAGAGCCAGTGG + Intergenic
1031657770 7:124379721-124379743 TGTGCTGAGCTCAGAGCCAATGG + Intergenic
1031862228 7:126993946-126993968 TGTGCTGGACTTAGAGCCAGTGG + Intronic
1031905672 7:127457744-127457766 TGTCCTGGGCTCAGAGACAGTGG + Intergenic
1031921619 7:127606243-127606265 TGCCCAAGGCTCAGAGCCTGAGG + Intergenic
1032013116 7:128359733-128359755 TGGGCCAGGCCAGGAGCCAGGGG - Exonic
1032081081 7:128858763-128858785 GGGGCCAGGCTCAGGGGCAGAGG + Exonic
1032091170 7:128912394-128912416 GGGGCCAGGCTCAGTGGCAGAGG - Intergenic
1032138864 7:129308129-129308151 TGTGCTGGGCTTGGAGCCAGGGG - Intronic
1033042996 7:137935611-137935633 TGGGCTAGGTCCAGAGAGAGGGG - Intronic
1033499830 7:141936664-141936686 TGAGCTGGGCTTTGAGCCAGTGG + Intronic
1033502536 7:141966222-141966244 TAAGCTAGGCTCAGAGCCAGTGG - Intronic
1033670807 7:143490962-143490984 GGTTCTAGGGTCAGAGCCAGGGG + Intergenic
1033814080 7:145051381-145051403 TGAACTAGGCTCAAGGCCAGTGG - Intergenic
1033875316 7:145810556-145810578 TGACCTGGGCTCAGAGCCAGTGG + Intergenic
1034063077 7:148110685-148110707 AGGGCCGGGCTCAGAGCCGGAGG + Intronic
1034343261 7:150371266-150371288 TGGGCCAGGCCCATGGCCAGGGG - Exonic
1034581877 7:152050660-152050682 TGGGCTGGGCTTGGAGCCAATGG - Intronic
1035064568 7:156095463-156095485 TGGGTCAGGATCAGAACCAGGGG + Intergenic
1035139017 7:156738446-156738468 TGGGCTGGGCTTAGAGCCAGTGG + Intronic
1035650377 8:1259631-1259653 TGGGCTGGGCTCTGACCCAAAGG - Intergenic
1036570247 8:9974082-9974104 TGGCCTGGGCACAGGGCCAGAGG + Intergenic
1036814893 8:11894761-11894783 TGTGGTGGGCTCAGAGCCAGTGG - Intergenic
1037254770 8:16941406-16941428 TAGGCTCGGCTTAGAGCCAGTGG + Intergenic
1039825627 8:41171868-41171890 GGGGCTGGGCTCAGAGACATGGG - Intergenic
1040397731 8:47015416-47015438 TGAACTAGGCCCAGAGACAGTGG - Intergenic
1040485654 8:47869134-47869156 TGGGCTGGGCTCAGAACAAGTGG + Intronic
1040743207 8:50605281-50605303 TAGGCTGGGCTTAGAGCCAGTGG - Intronic
1040745491 8:50636319-50636341 TCTGCTGGGCTCAAAGCCAGTGG - Intronic
1041311911 8:56525809-56525831 AGGGATAAGCACAGAGCCAGAGG + Intergenic
1041615957 8:59907119-59907141 TCTCCTGGGCTCAGAGCCAGTGG + Intergenic
1041869337 8:62615510-62615532 TGAACTAGGCCCAGAGACAGTGG - Intronic
1042162553 8:65912090-65912112 TAGGCTGGGCTTAGAGCCAATGG + Intergenic
1042187751 8:66154060-66154082 TGTGGTCTGCTCAGAGCCAGTGG - Exonic
1042428108 8:68672728-68672750 TGTGCTGGGTTCAGAGGCAGTGG + Intronic
1042533457 8:69836396-69836418 TGGGCAAGGCCAAGGGCCAGTGG - Intergenic
1043226969 8:77745594-77745616 TGTGCTGGGCTTGGAGCCAGTGG + Intergenic
1043740250 8:83801948-83801970 TAAACTGGGCTCAGAGCCAGTGG - Intergenic
1045041398 8:98227790-98227812 TGTGCTAGGATTAGAACCAGTGG - Intronic
1045195146 8:99923104-99923126 TAGTCTAGTCTTAGAGCCAGTGG - Intergenic
1045370071 8:101514439-101514461 TGGGCTTGCCTCAGAGTCTGGGG - Intronic
1045592560 8:103614072-103614094 TGGGATGGGCTCAGAGCCAGAGG - Intronic
1045599051 8:103692912-103692934 TGTGCTGGGCTCAAAGCCAGTGG - Intronic
1045621151 8:103980041-103980063 CAGGCTGGGCTCAGAGCCAGAGG + Intronic
1045994836 8:108351177-108351199 TAGGCTAGGCTCAGGGCCAGAGG + Intronic
1046143040 8:110120379-110120401 TGGGGTTGGCTCAGAGCCAGTGG + Intergenic
1046215577 8:111141341-111141363 TATACTGGGCTCAGAGCCAGTGG - Intergenic
1046268260 8:111859337-111859359 TGAACTAGGCCCAGAGACAGTGG - Intergenic
1047089599 8:121558906-121558928 TGGGCTGGTCTCAGTGACAGTGG + Intergenic
1047342901 8:123999922-123999944 TATGCTGGGCTCAGAGACAGTGG - Intronic
1047841113 8:128754417-128754439 TGTGCTGGGCTTAGAGCCAGTGG + Intergenic
1047910048 8:129518164-129518186 TGAACTGGGCTGAGAGCCAGTGG + Intergenic
1047933558 8:129753103-129753125 TGAGCTAGGCTCAGAGCCAGAGG + Intronic
1048757712 8:137756537-137756559 TGAACTGGGCCCAGAGCCAGAGG + Intergenic
1049097288 8:140556515-140556537 TGGGCTGGGCACAGAGGCCGTGG - Intronic
1049116669 8:140694652-140694674 TGAGCTAGGCCCAGAGCTATTGG - Intronic
1049490162 8:142894088-142894110 TGAACTGGGCCCAGAGCCAGTGG - Intronic
1049783278 8:144438733-144438755 TGGGCTTGGCTCTGTTCCAGAGG - Exonic
1049965512 9:775876-775898 TGGATTCAGCTCAGAGCCAGAGG + Intergenic
1050145130 9:2559636-2559658 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1050355678 9:4780840-4780862 TGAACTGGGCTCAGAGCCAGTGG + Intergenic
1050578806 9:7028613-7028635 TGGACTGGGCTCAGAGCCACTGG - Intronic
1050618693 9:7429926-7429948 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1050930250 9:11313176-11313198 TGTCCTTGGCTCAGAGCCAGTGG - Intergenic
1051229940 9:14945531-14945553 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1051306649 9:15717443-15717465 TGTGCTGGGCTCGGAGCCAGTGG + Intronic
1051455153 9:17247167-17247189 TGTGCTAGACTCAGAGCCAGTGG - Intronic
1051966716 9:22836692-22836714 TATGCTGGGCTCAAAGCCAGTGG - Intergenic
1051992012 9:23162955-23162977 AGGGCTGGGCACAGTGCCAGTGG + Intergenic
1052063231 9:23986599-23986621 TGAACTAGGCCCAGAGCCAGTGG + Intergenic
1052204992 9:25828251-25828273 TAGACTGGGCTTAGAGCCAGTGG - Intergenic
1052214718 9:25951765-25951787 TGCACTAGGCCCAGAGACAGTGG - Intergenic
1052450566 9:28625015-28625037 TGGGCTGGTCTTCGAGCCAGGGG - Intronic
1052573832 9:30265268-30265290 TGTGTTGGGCTCAGAGCTAGCGG - Intergenic
1052607361 9:30722545-30722567 TGATCTGGGCTCAGAGTCAGTGG + Intergenic
1053110126 9:35452863-35452885 TGTACTGAGCTCAGAGCCAGTGG + Intergenic
1053750658 9:41251256-41251278 CGAGCTGGGCTCAGAGCCAGTGG + Intergenic
1054256169 9:62815599-62815621 CAAGCTGGGCTCAGAGCCAGTGG + Intergenic
1054335135 9:63800015-63800037 CGAGCTGGGCTCAGAGCCAGTGG - Intergenic
1054982499 9:71223006-71223028 TGAACTGGGCTCAGAGCCAGTGG + Intronic
1055227290 9:74014830-74014852 TGAGCTGGGCTCAGAGACAGAGG + Intergenic
1055301953 9:74891643-74891665 TGAGCTGGGCTCAGACCAAGTGG + Intergenic
1055387203 9:75775415-75775437 TGGACTGGGCTCAGAGCCAGTGG + Intergenic
1055886552 9:81069942-81069964 TAGGCTGGGCTCAGAGCCAGAGG - Intergenic
1056007185 9:82285216-82285238 TGAGCTAGGCTCAGACACAGTGG + Intergenic
1056180290 9:84076267-84076289 TGGGTTGGGCTCAGAGCCACAGG + Intergenic
1056190613 9:84180836-84180858 TGGGCAAGGGTCAGGGCAAGAGG + Intergenic
1056230656 9:84539461-84539483 TGTGCTGGGCTCAAAGCCCGTGG - Intergenic
1056516699 9:87359063-87359085 TGTGCTGGGTTCAGAGCCAGTGG + Intergenic
1057289146 9:93789344-93789366 TGTGGTAGGCTCAGAGCCAGTGG - Intergenic
1057963667 9:99481590-99481612 TGGGCAAGGGTCAGAGACAGAGG - Intergenic
1058003868 9:99895279-99895301 TGTGCTGGACTCAGAGCCAGTGG + Intergenic
1058226607 9:102371836-102371858 TGAACTAGGCCCAGAGACAGTGG - Intergenic
1058249149 9:102669431-102669453 TGAGCTGGGCTATGAGCCAGTGG - Intergenic
1058767729 9:108198345-108198367 TGAACTAGGCCCAGAGACAGTGG + Intergenic
1058820807 9:108727940-108727962 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1059445796 9:114337072-114337094 TGCGCCAGGCTCACAGCCTGCGG - Exonic
1059900693 9:118921841-118921863 TGGGCTAGGCTTAGAGCTAGTGG - Intergenic
1060821242 9:126662654-126662676 TGGGCTGGGCTGGGAGCCGGTGG + Intronic
1061156406 9:128864530-128864552 TGGGCTGGGCTATGGGCCAGAGG - Intronic
1061231432 9:129318166-129318188 GGCGCTAGGCTCAGGGCCGGAGG - Intergenic
1061638179 9:131928829-131928851 TGGGCTGGGCTTATAGCCAGTGG + Intronic
1061877162 9:133549994-133550016 AGGACTAGGCACAGGGCCAGAGG + Intronic
1061915677 9:133751978-133752000 TGAACTAGGCCCAGAGACAGTGG - Intergenic
1062291080 9:135794629-135794651 TGGGCAAAGCTGGGAGCCAGGGG + Intergenic
1062453313 9:136624556-136624578 TGGGTGAGGCTGAGAGCCAGGGG - Intergenic
1203371403 Un_KI270442v1:308984-309006 TGAGCTGGGCTCAGAGCCAGTGG - Intergenic
1185878012 X:3715056-3715078 TGGGCGAGGCTGGCAGCCAGGGG - Intergenic
1186601994 X:11048335-11048357 TGGGCTGGACTCAGAGCTGGAGG - Intergenic
1186602221 X:11050067-11050089 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1186911770 X:14174722-14174744 TGAACTAGGCTCAGAGCTGGGGG - Intergenic
1187091413 X:16100924-16100946 TGGGCAATGTTCAGAGCCACTGG + Intergenic
1187132628 X:16517433-16517455 TGGACTGGGCTTAGAGCCAGTGG + Intergenic
1187575088 X:20545729-20545751 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1187610668 X:20939536-20939558 TGAACTAGGCCCAGAGACAGTGG - Intergenic
1188027542 X:25226365-25226387 TGGGCTGGGCTCAGAGCCAGAGG + Intergenic
1188078598 X:25808296-25808318 TGAGATGGGCTCAGAGACAGCGG - Intergenic
1188651387 X:32634879-32634901 TGTGCCGGGCTCAGAGTCAGTGG - Intronic
1188716512 X:33465193-33465215 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1188972374 X:36633340-36633362 TGTACTGGGCTCAGAGCCAGTGG - Intergenic
1188974500 X:36657183-36657205 TGGGCTGGGCTTAGAGCCAGTGG - Intergenic
1189013523 X:37071429-37071451 TGGGCTGGCCTCAAGGCCAGTGG - Intergenic
1189019516 X:37319951-37319973 TGAACTGGGCCCAGAGCCAGTGG + Intergenic
1189405639 X:40720606-40720628 TAGGCTGGACTCAGAGCCAGAGG + Intronic
1189593773 X:42543062-42543084 TGAGCTGAGCTCAGAGCCAGTGG + Intergenic
1189628080 X:42921003-42921025 TATGCTGGGCTCAGAGCCAGTGG + Intergenic
1189640682 X:43067716-43067738 TGTGCTGGACTCAGAGCCAGTGG + Intergenic
1189690669 X:43613699-43613721 TGAACTGGGCTCAGAGACAGTGG - Intergenic
1189770149 X:44417216-44417238 TGAACTGGGCACAGAGCCAGTGG - Intergenic
1189868875 X:45361052-45361074 TGACCTGGGCCCAGAGCCAGTGG - Intergenic
1189874427 X:45420908-45420930 TGGATTGGGCTTAGAGCCAGTGG - Intergenic
1189890132 X:45592158-45592180 TGAACTGGGCTAAGAGCCAGTGG - Intergenic
1190015021 X:46819467-46819489 TGAACTGGGCTCAGAGCCAGTGG + Intergenic
1190046116 X:47112770-47112792 TGTGCTGGGCTTGGAGCCAGTGG + Intergenic
1190395783 X:49981360-49981382 TGTGTAAGGCTCAGAGACAGGGG - Intronic
1190498684 X:51053777-51053799 TGAACTAGGCCCAGAGACAGTGG - Intergenic
1190507892 X:51145665-51145687 TGCACTAGGCTCAGAGGCAGTGG - Intergenic
1190588210 X:51968241-51968263 TGGGCTGGGCCCAGAGCCAGAGG - Intergenic
1191059411 X:56278693-56278715 TGAACTGGGCTCAGAGCCAGTGG - Intronic
1191194190 X:57703926-57703948 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1191646608 X:63488403-63488425 TGTGCTTGGCTCAGAGCCAGTGG + Intergenic
1191991304 X:67039490-67039512 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1192046083 X:67675334-67675356 TGTGCTAGCCTCAGAGCCAGTGG - Intronic
1192069559 X:67922808-67922830 TGTGCTGGGTTCAGAACCAGTGG + Intergenic
1192161376 X:68790638-68790660 TGGGCTTGTCTCAGGGCCTGTGG + Intergenic
1192380713 X:70613650-70613672 TGAGCTGGGCTCAGAACCAATGG + Intronic
1192505739 X:71681061-71681083 TGTGCTGGGCTCAGAGCCAGAGG - Intergenic
1192640411 X:72856978-72857000 TGAGCTGGGCTCAGAGACAGAGG + Intergenic
1192641300 X:72863798-72863820 TGAGCTGGGCTCAGAGACAGAGG - Intergenic
1192769997 X:74178821-74178843 TGGGCTGCCCTCAGAGCCAGAGG - Intergenic
1192839266 X:74836827-74836849 TGGGCTAGGCTCAGAGCCAGAGG - Intronic
1192841104 X:74857126-74857148 TGAGCTGGGCTTAGAGCTAGTGG + Intronic
1192872612 X:75199140-75199162 TGAGCTAGGCTTATAGCCAGAGG + Intergenic
1193092473 X:77509880-77509902 TGTGCTGGGCTGAAAGCCAGTGG + Intronic
1193184137 X:78492378-78492400 TGGGGTAGCCTCACAGTCAGGGG + Intergenic
1193194916 X:78620113-78620135 TGTTCTGGGCTCAGAGCCAGTGG - Intergenic
1193213769 X:78838960-78838982 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1193219734 X:78910215-78910237 TGAACTTGGCTCAGAGCCAGTGG - Intergenic
1193246887 X:79239516-79239538 TGGGCTGGGCTTAGAGACAGTGG - Intergenic
1193289380 X:79753771-79753793 TGAGCTGTGCTCAGAGCTAGTGG - Intergenic
1193344471 X:80388779-80388801 TGTGCTGACCTCAGAGCCAGTGG - Intronic
1193366793 X:80644093-80644115 CATGCTGGGCTCAGAGCCAGTGG - Intergenic
1193396536 X:80990498-80990520 TGAGCTGGGCTCAGAGCCCGTGG + Intergenic
1193658304 X:84224992-84225014 TGTGCTTGGCTCAGAGCCAGTGG - Intergenic
1193742275 X:85231893-85231915 TGTGCTGGGCTCAGAGTTAGTGG + Intergenic
1193815655 X:86102106-86102128 TGAACTAGGCCCAGAGACAGTGG + Intergenic
1193856673 X:86611451-86611473 AGAGCTGGGCTCAAAGCCAGTGG - Intronic
1193856800 X:86612382-86612404 TGTGCTGAGCTTAGAGCCAGTGG - Intronic
1194264096 X:91734108-91734130 TGGGTGTGGCACAGAGCCAGAGG - Intergenic
1194288608 X:92040210-92040232 TGGGCTGGGCCTAGAGCCAGGGG - Intronic
1194327753 X:92541081-92541103 TAGGCTGGGCTTAGAGCCAGTGG - Intronic
1194366264 X:93018387-93018409 TGGGATTGGTGCAGAGCCAGGGG + Intergenic
1194388963 X:93292731-93292753 TGGTCTAGGCTCAGAGCCAGAGG + Intergenic
1194391450 X:93322325-93322347 TGAACTTGGCCCAGAGCCAGTGG - Intergenic
1194398129 X:93411719-93411741 TGTGCTGGGCTCGGAGTCAGTGG + Intergenic
1194435760 X:93867559-93867581 TGGGAGTGGCACAGAGCCAGGGG + Intergenic
1194466507 X:94240476-94240498 GGGGCTGGGCTTAAAGCCAGCGG - Intergenic
1194520594 X:94914394-94914416 TGAACTGGGCTTAGAGCCAGTGG + Intergenic
1194526410 X:94983116-94983138 TATGCTCGGCTTAGAGCCAGAGG + Intergenic
1194558494 X:95392764-95392786 TCTGCTGGGCTCAGAGTCAGTGG + Intergenic
1194679601 X:96836070-96836092 TTGGCTAGGCACAGTGACAGAGG - Intronic
1194877621 X:99208727-99208749 TGTGCTGGGCTTAGAGCCAGTGG - Intergenic
1194937706 X:99970858-99970880 TGTGCTGGGCTCAGAACCAATGG - Intergenic
1195123035 X:101775621-101775643 TGAACTAGGCCCAGAGACAGTGG - Intergenic
1195136115 X:101908865-101908887 TGAACTAGGCCCAGAGACAGTGG + Intronic
1195246894 X:103003120-103003142 AGGGCTAAGCTCAGAACTAGAGG + Intergenic
1195312211 X:103642862-103642884 TGTGCTGGGCTTAGAGCCAGTGG + Intergenic
1195601266 X:106751529-106751551 TGTGCTGGGCTCAGAACCAGAGG + Intronic
1195618710 X:106932612-106932634 TGTGCAAGGGTCAGAGCCATGGG - Intronic
1195662713 X:107396763-107396785 TGAGCTGGACTCAGAACCAGTGG - Intergenic
1195825011 X:108990278-108990300 TGTGCTAGGCTTAGAACTAGTGG - Intergenic
1195872173 X:109497907-109497929 TGTGCTGGGCTTAGAGTCAGTGG - Intergenic
1196215781 X:113050320-113050342 TAGGCTAGGCTCAGAGTCAGTGG + Intergenic
1196243095 X:113366409-113366431 TGGGCTGGGCTTAGTACCAGTGG - Intergenic
1196243155 X:113366855-113366877 TGAGTTGGGCTCAGATCCAGTGG - Intergenic
1196510183 X:116500001-116500023 TGATCTGGGCTCAGAGCCATAGG - Intergenic
1196513885 X:116546793-116546815 TGGGAGAGGCACAGAGCCAATGG - Intergenic
1196517523 X:116630920-116630942 TGAACCAGGCTCAGAGGCAGTGG + Intergenic
1196619517 X:117806600-117806622 TGTGCTGGGCTCAGAGCTACTGG + Intergenic
1196639170 X:118038762-118038784 TATGCTGGGCTCAAAGCCAGTGG + Intronic
1196962207 X:121015113-121015135 TGTGCTGGGCTCAGAGCCAGTGG - Intergenic
1196968912 X:121087366-121087388 TGGGATCAGCTCAGAGCCAGAGG - Intergenic
1197052643 X:122077961-122077983 TGAACTGGGCTCAGAACCAGTGG - Intergenic
1197099639 X:122637145-122637167 TGTGCTGGGCTCAGAGCCACTGG - Intergenic
1197112836 X:122797218-122797240 TGAACTAGGCCCAGAGACAGTGG + Intergenic
1197117674 X:122852274-122852296 TGAACTGGGCTCAGAGTCAGTGG + Intergenic
1197178003 X:123505050-123505072 CGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1197375920 X:125682010-125682032 TGAGATGGGCTCGGAGCCAGCGG + Intergenic
1197380897 X:125737264-125737286 TGTGCTGGGTTCAAAGCCAGTGG - Intergenic
1197437909 X:126455562-126455584 TGGACTGGGCCCAGAGACAGTGG + Intergenic
1197476676 X:126933538-126933560 TGAACTAGGCCCAGAGACAGTGG - Intergenic
1197481668 X:126994492-126994514 TGTACTGGGCTCACAGCCAGTGG + Intergenic
1197487811 X:127075194-127075216 TGTACTGGGCTGAGAGCCAGTGG - Intergenic
1197508951 X:127346769-127346791 TGAACTAGGCCCAGAGACAGTGG - Intergenic
1197558791 X:127992050-127992072 TGAACTGGGCTCAGAACCAGTGG + Intergenic
1197587320 X:128364371-128364393 TGCGCTGGGCTTGGAGCCAGTGG - Intergenic
1197670668 X:129273532-129273554 TGTGCTGGGCTTGGAGCCAGTGG - Intergenic
1197792638 X:130270797-130270819 TGGGCTGGTTTCAGAGGCAGAGG - Intergenic
1197953065 X:131918648-131918670 TGTGCTGGGCTTAGAGCCAGTGG + Intergenic
1198430899 X:136565259-136565281 TGAACTGGGCTCAAAGCCAGTGG - Intergenic
1198537517 X:137601071-137601093 TGAGCTGGGCTCAGAGTCAGTGG + Intergenic
1198611910 X:138411239-138411261 TGAACTTGGCTCAGAGCCAGTGG + Intergenic
1198636765 X:138710595-138710617 TGGGACAGGCGCAGAGCCTGGGG - Intronic
1198694800 X:139324555-139324577 TGGACTAGGCCTAGAGACAGTGG + Intergenic
1198761605 X:140038612-140038634 TGTGCTGGGCTCAGAGCCAGTGG + Intergenic
1198770649 X:140126631-140126653 TGGGCTGGGCTTAGAGCCAGTGG - Intergenic
1198938990 X:141931992-141932014 ACAGCTGGGCTCAGAGCCAGTGG - Intergenic
1198947643 X:142031965-142031987 TGTTCTCGGCTCAGACCCAGTGG - Intergenic
1199032167 X:143013479-143013501 TGAAATAGGCTCAGAGACAGTGG + Intergenic
1199036248 X:143053823-143053845 TGAGCTGGGCTTAGAGACAGGGG - Intergenic
1199115290 X:143985125-143985147 TGAACTAGGCCCAGAGACAGTGG - Intergenic
1199133182 X:144219147-144219169 TGAGCTGGGCTCAGAGCCAATGG - Intergenic
1199138966 X:144287688-144287710 TGGGCTAGGCTCAGAGTCAGTGG - Intergenic
1199277558 X:145964193-145964215 TGGGATGGACTTAGAGCCAGAGG + Intergenic
1199303864 X:146244642-146244664 TGTGCTGGGCTCAAAACCAGTGG + Intergenic
1199439735 X:147854622-147854644 TGAACTAGGCCCAGAGTCAGTGG - Intergenic
1199547244 X:149019132-149019154 TAGGATAGGCTCAGAGCCCCAGG - Intergenic
1199962855 X:152792013-152792035 TGGGCTAAGCTCAGAGCCAGTGG + Intergenic
1200177255 X:154125805-154125827 TGGACTGGGCTCGGAGCCAGCGG + Intergenic
1200370057 X:155715613-155715635 TGAACTGGGCTCAGAGCCAGTGG - Intergenic
1200379459 X:155819669-155819691 TGCACTGTGCTCAGAGCCAGTGG + Intergenic
1200606129 Y:5264775-5264797 TGGGCTGGGCCTAGAGCCAGGGG - Intronic
1200636467 Y:5660299-5660321 TAGGCTGGGCTTAGAGCCAGTGG - Intronic
1200674489 Y:6134649-6134671 TGGGATTGGTGCAGAGCCAGGGG + Intergenic
1200787368 Y:7272738-7272760 TGGGCGAGGCTAGCAGCCAGGGG + Intergenic
1201066941 Y:10106099-10106121 CGAGCTGGGCTCAGAGCCAGTGG + Intergenic
1202094208 Y:21228050-21228072 TGAACTAAGCTCAGAGACAGTGG - Intergenic