ID: 1111542635 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:89689089-89689111 |
Sequence | ACCAGAGTAGCATGTGATCT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1111542632_1111542635 | 8 | Left | 1111542632 | 13:89689058-89689080 | CCTCGTGCTGGGCTAGGCTCAGA | No data | ||
Right | 1111542635 | 13:89689089-89689111 | ACCAGAGTAGCATGTGATCTAGG | No data | ||||
1111542629_1111542635 | 19 | Left | 1111542629 | 13:89689047-89689069 | CCTAGGCAACTCCTCGTGCTGGG | No data | ||
Right | 1111542635 | 13:89689089-89689111 | ACCAGAGTAGCATGTGATCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1111542635 | Original CRISPR | ACCAGAGTAGCATGTGATCT AGG | Intergenic | ||