ID: 1111542635

View in Genome Browser
Species Human (GRCh38)
Location 13:89689089-89689111
Sequence ACCAGAGTAGCATGTGATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111542629_1111542635 19 Left 1111542629 13:89689047-89689069 CCTAGGCAACTCCTCGTGCTGGG No data
Right 1111542635 13:89689089-89689111 ACCAGAGTAGCATGTGATCTAGG No data
1111542632_1111542635 8 Left 1111542632 13:89689058-89689080 CCTCGTGCTGGGCTAGGCTCAGA No data
Right 1111542635 13:89689089-89689111 ACCAGAGTAGCATGTGATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111542635 Original CRISPR ACCAGAGTAGCATGTGATCT AGG Intergenic
No off target data available for this crispr