ID: 1111542637

View in Genome Browser
Species Human (GRCh38)
Location 13:89689090-89689112
Sequence CCAGAGTAGCATGTGATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111542632_1111542637 9 Left 1111542632 13:89689058-89689080 CCTCGTGCTGGGCTAGGCTCAGA No data
Right 1111542637 13:89689090-89689112 CCAGAGTAGCATGTGATCTAGGG No data
1111542629_1111542637 20 Left 1111542629 13:89689047-89689069 CCTAGGCAACTCCTCGTGCTGGG No data
Right 1111542637 13:89689090-89689112 CCAGAGTAGCATGTGATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111542637 Original CRISPR CCAGAGTAGCATGTGATCTA GGG Intergenic
No off target data available for this crispr