ID: 1111544303

View in Genome Browser
Species Human (GRCh38)
Location 13:89710399-89710421
Sequence ATTCACATCAATACTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111544303_1111544308 -2 Left 1111544303 13:89710399-89710421 CCTTCCTGAGTATTGATGTGAAT No data
Right 1111544308 13:89710420-89710442 ATCTTAATATATGGTGGGTGTGG No data
1111544303_1111544307 -7 Left 1111544303 13:89710399-89710421 CCTTCCTGAGTATTGATGTGAAT No data
Right 1111544307 13:89710415-89710437 TGTGAATCTTAATATATGGTGGG No data
1111544303_1111544306 -8 Left 1111544303 13:89710399-89710421 CCTTCCTGAGTATTGATGTGAAT No data
Right 1111544306 13:89710414-89710436 ATGTGAATCTTAATATATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111544303 Original CRISPR ATTCACATCAATACTCAGGA AGG (reversed) Intergenic
No off target data available for this crispr