ID: 1111561113

View in Genome Browser
Species Human (GRCh38)
Location 13:89948181-89948203
Sequence GAGCAGCTTGTAGGCCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111561110_1111561113 3 Left 1111561110 13:89948155-89948177 CCCTTGTATTTTTATATGCATTT No data
Right 1111561113 13:89948181-89948203 GAGCAGCTTGTAGGCCAAAAAGG No data
1111561111_1111561113 2 Left 1111561111 13:89948156-89948178 CCTTGTATTTTTATATGCATTTC No data
Right 1111561113 13:89948181-89948203 GAGCAGCTTGTAGGCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111561113 Original CRISPR GAGCAGCTTGTAGGCCAAAA AGG Intergenic
No off target data available for this crispr