ID: 1111574786

View in Genome Browser
Species Human (GRCh38)
Location 13:90138486-90138508
Sequence CCATGGGGAGTTTTATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111574781_1111574786 18 Left 1111574781 13:90138445-90138467 CCTAAAATATGATGGTTCATAGT No data
Right 1111574786 13:90138486-90138508 CCATGGGGAGTTTTATCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111574786 Original CRISPR CCATGGGGAGTTTTATCTCC AGG Intergenic
No off target data available for this crispr