ID: 1111578853

View in Genome Browser
Species Human (GRCh38)
Location 13:90196306-90196328
Sequence CTCCAGAGAAACACTTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111578853_1111578858 21 Left 1111578853 13:90196306-90196328 CCTTCACAAGTGTTTCTCTGGAG No data
Right 1111578858 13:90196350-90196372 CTGATGCCTCTTTCATTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111578853 Original CRISPR CTCCAGAGAAACACTTGTGA AGG (reversed) Intergenic
No off target data available for this crispr