ID: 1111582351

View in Genome Browser
Species Human (GRCh38)
Location 13:90239099-90239121
Sequence ACCATAGCACTATCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111582347_1111582351 -1 Left 1111582347 13:90239077-90239099 CCATTACTCTCCCTATCATTTGA No data
Right 1111582351 13:90239099-90239121 ACCATAGCACTATCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111582351 Original CRISPR ACCATAGCACTATCCAGGAG AGG Intergenic
No off target data available for this crispr