ID: 1111585324

View in Genome Browser
Species Human (GRCh38)
Location 13:90276597-90276619
Sequence AAAAAATGTATTACGGGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111585324_1111585327 -5 Left 1111585324 13:90276597-90276619 CCTATACCCGTAATACATTTTTT No data
Right 1111585327 13:90276615-90276637 TTTTTTTGACATGTTTAAACAGG No data
1111585324_1111585328 7 Left 1111585324 13:90276597-90276619 CCTATACCCGTAATACATTTTTT No data
Right 1111585328 13:90276627-90276649 GTTTAAACAGGACTCTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111585324 Original CRISPR AAAAAATGTATTACGGGTAT AGG (reversed) Intergenic