ID: 1111585325

View in Genome Browser
Species Human (GRCh38)
Location 13:90276603-90276625
Sequence TGTCAAAAAAAATGTATTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111585325_1111585328 1 Left 1111585325 13:90276603-90276625 CCCGTAATACATTTTTTTTGACA No data
Right 1111585328 13:90276627-90276649 GTTTAAACAGGACTCTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111585325 Original CRISPR TGTCAAAAAAAATGTATTAC GGG (reversed) Intergenic