ID: 1111585326

View in Genome Browser
Species Human (GRCh38)
Location 13:90276604-90276626
Sequence ATGTCAAAAAAAATGTATTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111585326_1111585328 0 Left 1111585326 13:90276604-90276626 CCGTAATACATTTTTTTTGACAT No data
Right 1111585328 13:90276627-90276649 GTTTAAACAGGACTCTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111585326 Original CRISPR ATGTCAAAAAAAATGTATTA CGG (reversed) Intergenic