ID: 1111592460

View in Genome Browser
Species Human (GRCh38)
Location 13:90367834-90367856
Sequence AAACACCAAGGGTTCAGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111592460_1111592466 14 Left 1111592460 13:90367834-90367856 CCTAGACTGAACCCTTGGTGTTT No data
Right 1111592466 13:90367871-90367893 CAAAGAAGAGGATGAGGAAGAGG No data
1111592460_1111592463 -10 Left 1111592460 13:90367834-90367856 CCTAGACTGAACCCTTGGTGTTT No data
Right 1111592463 13:90367847-90367869 CTTGGTGTTTCAGTAACAGAAGG No data
1111592460_1111592469 29 Left 1111592460 13:90367834-90367856 CCTAGACTGAACCCTTGGTGTTT No data
Right 1111592469 13:90367886-90367908 GGAAGAGGAAAAGGAGGCCGAGG No data
1111592460_1111592465 8 Left 1111592460 13:90367834-90367856 CCTAGACTGAACCCTTGGTGTTT No data
Right 1111592465 13:90367865-90367887 GAAGGACAAAGAAGAGGATGAGG No data
1111592460_1111592468 23 Left 1111592460 13:90367834-90367856 CCTAGACTGAACCCTTGGTGTTT No data
Right 1111592468 13:90367880-90367902 GGATGAGGAAGAGGAAAAGGAGG No data
1111592460_1111592464 2 Left 1111592460 13:90367834-90367856 CCTAGACTGAACCCTTGGTGTTT No data
Right 1111592464 13:90367859-90367881 GTAACAGAAGGACAAAGAAGAGG No data
1111592460_1111592467 20 Left 1111592460 13:90367834-90367856 CCTAGACTGAACCCTTGGTGTTT No data
Right 1111592467 13:90367877-90367899 AGAGGATGAGGAAGAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111592460 Original CRISPR AAACACCAAGGGTTCAGTCT AGG (reversed) Intergenic