ID: 1111592461

View in Genome Browser
Species Human (GRCh38)
Location 13:90367845-90367867
Sequence TTCTGTTACTGAAACACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 3, 2: 35, 3: 110, 4: 394}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111592461_1111592470 30 Left 1111592461 13:90367845-90367867 CCCTTGGTGTTTCAGTAACAGAA 0: 1
1: 3
2: 35
3: 110
4: 394
Right 1111592470 13:90367898-90367920 GGAGGCCGAGGAAAAGAAGAAGG No data
1111592461_1111592464 -9 Left 1111592461 13:90367845-90367867 CCCTTGGTGTTTCAGTAACAGAA 0: 1
1: 3
2: 35
3: 110
4: 394
Right 1111592464 13:90367859-90367881 GTAACAGAAGGACAAAGAAGAGG No data
1111592461_1111592469 18 Left 1111592461 13:90367845-90367867 CCCTTGGTGTTTCAGTAACAGAA 0: 1
1: 3
2: 35
3: 110
4: 394
Right 1111592469 13:90367886-90367908 GGAAGAGGAAAAGGAGGCCGAGG No data
1111592461_1111592468 12 Left 1111592461 13:90367845-90367867 CCCTTGGTGTTTCAGTAACAGAA 0: 1
1: 3
2: 35
3: 110
4: 394
Right 1111592468 13:90367880-90367902 GGATGAGGAAGAGGAAAAGGAGG No data
1111592461_1111592466 3 Left 1111592461 13:90367845-90367867 CCCTTGGTGTTTCAGTAACAGAA 0: 1
1: 3
2: 35
3: 110
4: 394
Right 1111592466 13:90367871-90367893 CAAAGAAGAGGATGAGGAAGAGG No data
1111592461_1111592465 -3 Left 1111592461 13:90367845-90367867 CCCTTGGTGTTTCAGTAACAGAA 0: 1
1: 3
2: 35
3: 110
4: 394
Right 1111592465 13:90367865-90367887 GAAGGACAAAGAAGAGGATGAGG No data
1111592461_1111592467 9 Left 1111592461 13:90367845-90367867 CCCTTGGTGTTTCAGTAACAGAA 0: 1
1: 3
2: 35
3: 110
4: 394
Right 1111592467 13:90367877-90367899 AGAGGATGAGGAAGAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111592461 Original CRISPR TTCTGTTACTGAAACACCAA GGG (reversed) Intergenic