ID: 1111592462

View in Genome Browser
Species Human (GRCh38)
Location 13:90367846-90367868
Sequence CTTCTGTTACTGAAACACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111592462_1111592467 8 Left 1111592462 13:90367846-90367868 CCTTGGTGTTTCAGTAACAGAAG No data
Right 1111592467 13:90367877-90367899 AGAGGATGAGGAAGAGGAAAAGG No data
1111592462_1111592465 -4 Left 1111592462 13:90367846-90367868 CCTTGGTGTTTCAGTAACAGAAG No data
Right 1111592465 13:90367865-90367887 GAAGGACAAAGAAGAGGATGAGG No data
1111592462_1111592468 11 Left 1111592462 13:90367846-90367868 CCTTGGTGTTTCAGTAACAGAAG No data
Right 1111592468 13:90367880-90367902 GGATGAGGAAGAGGAAAAGGAGG No data
1111592462_1111592466 2 Left 1111592462 13:90367846-90367868 CCTTGGTGTTTCAGTAACAGAAG No data
Right 1111592466 13:90367871-90367893 CAAAGAAGAGGATGAGGAAGAGG No data
1111592462_1111592469 17 Left 1111592462 13:90367846-90367868 CCTTGGTGTTTCAGTAACAGAAG No data
Right 1111592469 13:90367886-90367908 GGAAGAGGAAAAGGAGGCCGAGG No data
1111592462_1111592470 29 Left 1111592462 13:90367846-90367868 CCTTGGTGTTTCAGTAACAGAAG No data
Right 1111592470 13:90367898-90367920 GGAGGCCGAGGAAAAGAAGAAGG No data
1111592462_1111592464 -10 Left 1111592462 13:90367846-90367868 CCTTGGTGTTTCAGTAACAGAAG No data
Right 1111592464 13:90367859-90367881 GTAACAGAAGGACAAAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111592462 Original CRISPR CTTCTGTTACTGAAACACCA AGG (reversed) Intergenic