ID: 1111592467

View in Genome Browser
Species Human (GRCh38)
Location 13:90367877-90367899
Sequence AGAGGATGAGGAAGAGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111592461_1111592467 9 Left 1111592461 13:90367845-90367867 CCCTTGGTGTTTCAGTAACAGAA No data
Right 1111592467 13:90367877-90367899 AGAGGATGAGGAAGAGGAAAAGG No data
1111592462_1111592467 8 Left 1111592462 13:90367846-90367868 CCTTGGTGTTTCAGTAACAGAAG No data
Right 1111592467 13:90367877-90367899 AGAGGATGAGGAAGAGGAAAAGG No data
1111592460_1111592467 20 Left 1111592460 13:90367834-90367856 CCTAGACTGAACCCTTGGTGTTT No data
Right 1111592467 13:90367877-90367899 AGAGGATGAGGAAGAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111592467 Original CRISPR AGAGGATGAGGAAGAGGAAA AGG Intergenic