ID: 1111594602

View in Genome Browser
Species Human (GRCh38)
Location 13:90395612-90395634
Sequence ATGCCCTTCTAGAAGACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111594602_1111594605 2 Left 1111594602 13:90395612-90395634 CCATCAGTCTTCTAGAAGGGCAT No data
Right 1111594605 13:90395637-90395659 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111594602 Original CRISPR ATGCCCTTCTAGAAGACTGA TGG (reversed) Intergenic
No off target data available for this crispr