ID: 1111595282

View in Genome Browser
Species Human (GRCh38)
Location 13:90403619-90403641
Sequence TGGGCATCCCTGTACTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111595270_1111595282 25 Left 1111595270 13:90403571-90403593 CCCGTGCTCCCGTATGCAACTGC No data
Right 1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG No data
1111595271_1111595282 24 Left 1111595271 13:90403572-90403594 CCGTGCTCCCGTATGCAACTGCA No data
Right 1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG No data
1111595273_1111595282 16 Left 1111595273 13:90403580-90403602 CCGTATGCAACTGCAGCTCCCTA No data
Right 1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG No data
1111595269_1111595282 26 Left 1111595269 13:90403570-90403592 CCCCGTGCTCCCGTATGCAACTG No data
Right 1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG No data
1111595272_1111595282 17 Left 1111595272 13:90403579-90403601 CCCGTATGCAACTGCAGCTCCCT No data
Right 1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG No data
1111595277_1111595282 -3 Left 1111595277 13:90403599-90403621 CCTAGCTGTGGCTGTGGACCTGG No data
Right 1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG No data
1111595276_1111595282 -2 Left 1111595276 13:90403598-90403620 CCCTAGCTGTGGCTGTGGACCTG No data
Right 1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111595282 Original CRISPR TGGGCATCCCTGTACTCTCA GGG Intergenic
No off target data available for this crispr