ID: 1111598033

View in Genome Browser
Species Human (GRCh38)
Location 13:90435682-90435704
Sequence CTGTAGGTAAGGAGCTGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111598033_1111598037 -4 Left 1111598033 13:90435682-90435704 CCAATTCAGCTCCTTACCTACAG No data
Right 1111598037 13:90435701-90435723 ACAGATGAGGCTCAAGCTGAAGG No data
1111598033_1111598038 -1 Left 1111598033 13:90435682-90435704 CCAATTCAGCTCCTTACCTACAG No data
Right 1111598038 13:90435704-90435726 GATGAGGCTCAAGCTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111598033 Original CRISPR CTGTAGGTAAGGAGCTGAAT TGG (reversed) Intergenic
No off target data available for this crispr