ID: 1111598521

View in Genome Browser
Species Human (GRCh38)
Location 13:90441991-90442013
Sequence GTGTGAAAGGAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111598521_1111598526 20 Left 1111598521 13:90441991-90442013 CCCTCCTCCTTCTCCTTTCACAC No data
Right 1111598526 13:90442034-90442056 TCTTCCTACACCTGATTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111598521 Original CRISPR GTGTGAAAGGAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr