ID: 1111598951

View in Genome Browser
Species Human (GRCh38)
Location 13:90447175-90447197
Sequence GCTGGAGTGGAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111598951_1111598960 13 Left 1111598951 13:90447175-90447197 CCATCCTCCTTCTCCACTCCAGC No data
Right 1111598960 13:90447211-90447233 TCTGTGGCCATCCTCAGCAGGGG No data
1111598951_1111598956 -3 Left 1111598951 13:90447175-90447197 CCATCCTCCTTCTCCACTCCAGC No data
Right 1111598956 13:90447195-90447217 AGCCAGTTACTTCTGCTCTGTGG No data
1111598951_1111598959 12 Left 1111598951 13:90447175-90447197 CCATCCTCCTTCTCCACTCCAGC No data
Right 1111598959 13:90447210-90447232 CTCTGTGGCCATCCTCAGCAGGG No data
1111598951_1111598962 19 Left 1111598951 13:90447175-90447197 CCATCCTCCTTCTCCACTCCAGC No data
Right 1111598962 13:90447217-90447239 GCCATCCTCAGCAGGGGCCTGGG No data
1111598951_1111598958 11 Left 1111598951 13:90447175-90447197 CCATCCTCCTTCTCCACTCCAGC No data
Right 1111598958 13:90447209-90447231 GCTCTGTGGCCATCCTCAGCAGG No data
1111598951_1111598961 18 Left 1111598951 13:90447175-90447197 CCATCCTCCTTCTCCACTCCAGC No data
Right 1111598961 13:90447216-90447238 GGCCATCCTCAGCAGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111598951 Original CRISPR GCTGGAGTGGAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr