ID: 1111602646

View in Genome Browser
Species Human (GRCh38)
Location 13:90494599-90494621
Sequence GTATTTCATAAGAAGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111602645_1111602646 1 Left 1111602645 13:90494575-90494597 CCTGAAACATCTATCTTTGTATA No data
Right 1111602646 13:90494599-90494621 GTATTTCATAAGAAGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111602646 Original CRISPR GTATTTCATAAGAAGCTCTG TGG Intergenic
No off target data available for this crispr