ID: 1111602975

View in Genome Browser
Species Human (GRCh38)
Location 13:90497044-90497066
Sequence GATAATTTATGTTCAGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111602975_1111602976 -9 Left 1111602975 13:90497044-90497066 CCAACAGCTGAACATAAATTATC No data
Right 1111602976 13:90497058-90497080 TAAATTATCCTAGAACAATAAGG No data
1111602975_1111602977 -8 Left 1111602975 13:90497044-90497066 CCAACAGCTGAACATAAATTATC No data
Right 1111602977 13:90497059-90497081 AAATTATCCTAGAACAATAAGGG No data
1111602975_1111602979 7 Left 1111602975 13:90497044-90497066 CCAACAGCTGAACATAAATTATC No data
Right 1111602979 13:90497074-90497096 AATAAGGGCAAAAAAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111602975 Original CRISPR GATAATTTATGTTCAGCTGT TGG (reversed) Intergenic
No off target data available for this crispr