ID: 1111603851

View in Genome Browser
Species Human (GRCh38)
Location 13:90510878-90510900
Sequence TGGTATGTCCATACAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111603848_1111603851 7 Left 1111603848 13:90510848-90510870 CCATTAATTAGTAAATAGATGAG No data
Right 1111603851 13:90510878-90510900 TGGTATGTCCATACAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111603851 Original CRISPR TGGTATGTCCATACAATGGA AGG Intergenic
No off target data available for this crispr