ID: 1111606411

View in Genome Browser
Species Human (GRCh38)
Location 13:90545632-90545654
Sequence TTTCCTGGATGCTGGCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111606411_1111606417 18 Left 1111606411 13:90545632-90545654 CCTCTTGGCCAGCATCCAGGAAA No data
Right 1111606417 13:90545673-90545695 ATTGAAGGATGATAAATGTGGGG No data
1111606411_1111606414 3 Left 1111606411 13:90545632-90545654 CCTCTTGGCCAGCATCCAGGAAA No data
Right 1111606414 13:90545658-90545680 GAAGTCATGCAGAAAATTGAAGG No data
1111606411_1111606415 16 Left 1111606411 13:90545632-90545654 CCTCTTGGCCAGCATCCAGGAAA No data
Right 1111606415 13:90545671-90545693 AAATTGAAGGATGATAAATGTGG No data
1111606411_1111606416 17 Left 1111606411 13:90545632-90545654 CCTCTTGGCCAGCATCCAGGAAA No data
Right 1111606416 13:90545672-90545694 AATTGAAGGATGATAAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111606411 Original CRISPR TTTCCTGGATGCTGGCCAAG AGG (reversed) Intergenic