ID: 1111615865

View in Genome Browser
Species Human (GRCh38)
Location 13:90660977-90660999
Sequence CATTCTGTTCTGAAGATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111615861_1111615865 3 Left 1111615861 13:90660951-90660973 CCATATATACCCAAAGGAATATA No data
Right 1111615865 13:90660977-90660999 CATTCTGTTCTGAAGATACATGG No data
1111615858_1111615865 21 Left 1111615858 13:90660933-90660955 CCATTTGATGCAGTAATCCCATA No data
Right 1111615865 13:90660977-90660999 CATTCTGTTCTGAAGATACATGG No data
1111615862_1111615865 -6 Left 1111615862 13:90660960-90660982 CCCAAAGGAATATAAACCATTCT 0: 58
1: 2202
2: 7177
3: 21317
4: 9589
Right 1111615865 13:90660977-90660999 CATTCTGTTCTGAAGATACATGG No data
1111615863_1111615865 -7 Left 1111615863 13:90660961-90660983 CCAAAGGAATATAAACCATTCTG No data
Right 1111615865 13:90660977-90660999 CATTCTGTTCTGAAGATACATGG No data
1111615860_1111615865 4 Left 1111615860 13:90660950-90660972 CCCATATATACCCAAAGGAATAT No data
Right 1111615865 13:90660977-90660999 CATTCTGTTCTGAAGATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111615865 Original CRISPR CATTCTGTTCTGAAGATACA TGG Intergenic
No off target data available for this crispr