ID: 1111619844

View in Genome Browser
Species Human (GRCh38)
Location 13:90710417-90710439
Sequence TATCCTTCCCCCAGTGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111619844_1111619847 7 Left 1111619844 13:90710417-90710439 CCTAACTCACTGGGGGAAGGATA No data
Right 1111619847 13:90710447-90710469 GAGTATTCCCTTCCGTGTTGGGG No data
1111619844_1111619845 5 Left 1111619844 13:90710417-90710439 CCTAACTCACTGGGGGAAGGATA No data
Right 1111619845 13:90710445-90710467 AAGAGTATTCCCTTCCGTGTTGG No data
1111619844_1111619846 6 Left 1111619844 13:90710417-90710439 CCTAACTCACTGGGGGAAGGATA No data
Right 1111619846 13:90710446-90710468 AGAGTATTCCCTTCCGTGTTGGG No data
1111619844_1111619848 8 Left 1111619844 13:90710417-90710439 CCTAACTCACTGGGGGAAGGATA No data
Right 1111619848 13:90710448-90710470 AGTATTCCCTTCCGTGTTGGGGG No data
1111619844_1111619849 9 Left 1111619844 13:90710417-90710439 CCTAACTCACTGGGGGAAGGATA No data
Right 1111619849 13:90710449-90710471 GTATTCCCTTCCGTGTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111619844 Original CRISPR TATCCTTCCCCCAGTGAGTT AGG (reversed) Intergenic
No off target data available for this crispr