ID: 1111634594

View in Genome Browser
Species Human (GRCh38)
Location 13:90887708-90887730
Sequence CACATCATGTTCTCTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111634594_1111634595 13 Left 1111634594 13:90887708-90887730 CCTGACACAGAGAACATGATGTG No data
Right 1111634595 13:90887744-90887766 AAACATCAAATTCTTTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111634594 Original CRISPR CACATCATGTTCTCTGTGTC AGG (reversed) Intergenic
No off target data available for this crispr