ID: 1111634595

View in Genome Browser
Species Human (GRCh38)
Location 13:90887744-90887766
Sequence AAACATCAAATTCTTTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111634593_1111634595 14 Left 1111634593 13:90887707-90887729 CCCTGACACAGAGAACATGATGT No data
Right 1111634595 13:90887744-90887766 AAACATCAAATTCTTTAGATTGG No data
1111634594_1111634595 13 Left 1111634594 13:90887708-90887730 CCTGACACAGAGAACATGATGTG No data
Right 1111634595 13:90887744-90887766 AAACATCAAATTCTTTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111634595 Original CRISPR AAACATCAAATTCTTTAGAT TGG Intergenic
No off target data available for this crispr