ID: 1111637878

View in Genome Browser
Species Human (GRCh38)
Location 13:90928907-90928929
Sequence CAGGCACATCCTACTGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111637866_1111637878 29 Left 1111637866 13:90928855-90928877 CCTTTTTAAGGAGTCAAATCCCC No data
Right 1111637878 13:90928907-90928929 CAGGCACATCCTACTGTCTTGGG No data
1111637871_1111637878 9 Left 1111637871 13:90928875-90928897 CCCAGGGATTTTCACTGAGGCCA No data
Right 1111637878 13:90928907-90928929 CAGGCACATCCTACTGTCTTGGG No data
1111637870_1111637878 10 Left 1111637870 13:90928874-90928896 CCCCAGGGATTTTCACTGAGGCC No data
Right 1111637878 13:90928907-90928929 CAGGCACATCCTACTGTCTTGGG No data
1111637872_1111637878 8 Left 1111637872 13:90928876-90928898 CCAGGGATTTTCACTGAGGCCAC No data
Right 1111637878 13:90928907-90928929 CAGGCACATCCTACTGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111637878 Original CRISPR CAGGCACATCCTACTGTCTT GGG Intergenic
No off target data available for this crispr