ID: 1111639193

View in Genome Browser
Species Human (GRCh38)
Location 13:90946625-90946647
Sequence AGGGAGAGCATAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111639180_1111639193 25 Left 1111639180 13:90946577-90946599 CCTGGCAGTAGCCACGTCGCACA No data
Right 1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG No data
1111639179_1111639193 26 Left 1111639179 13:90946576-90946598 CCCTGGCAGTAGCCACGTCGCAC No data
Right 1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG No data
1111639185_1111639193 14 Left 1111639185 13:90946588-90946610 CCACGTCGCACAGGGAGGGAATC No data
Right 1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111639193 Original CRISPR AGGGAGAGCATAGTGATTGT GGG Intergenic
No off target data available for this crispr