ID: 1111640097

View in Genome Browser
Species Human (GRCh38)
Location 13:90957776-90957798
Sequence AAATATCTACAAATAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111640096_1111640097 3 Left 1111640096 13:90957750-90957772 CCAAATAATTTATATTGAAACGC No data
Right 1111640097 13:90957776-90957798 AAATATCTACAAATAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111640097 Original CRISPR AAATATCTACAAATAGAGCA AGG Intergenic
No off target data available for this crispr