ID: 1111643504

View in Genome Browser
Species Human (GRCh38)
Location 13:91000951-91000973
Sequence TTCAAGTTAGAAATACTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111643504_1111643507 7 Left 1111643504 13:91000951-91000973 CCACCTAGTATTTCTAACTTGAA No data
Right 1111643507 13:91000981-91001003 AACTGTTTTTAAATGTTTCCAGG No data
1111643504_1111643508 17 Left 1111643504 13:91000951-91000973 CCACCTAGTATTTCTAACTTGAA No data
Right 1111643508 13:91000991-91001013 AAATGTTTCCAGGTAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111643504 Original CRISPR TTCAAGTTAGAAATACTAGG TGG (reversed) Intergenic
No off target data available for this crispr