ID: 1111645164

View in Genome Browser
Species Human (GRCh38)
Location 13:91023209-91023231
Sequence GGGGTTGTAATGCAGCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111645164_1111645169 1 Left 1111645164 13:91023209-91023231 CCCACATGCTGCATTACAACCCC No data
Right 1111645169 13:91023233-91023255 TATGTACATGCAGACCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111645164 Original CRISPR GGGGTTGTAATGCAGCATGT GGG (reversed) Intergenic
No off target data available for this crispr