ID: 1111646687 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:91040371-91040393 |
| Sequence | CTGCTCATCTTGAAGAGAAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1111646687_1111646690 | 27 | Left | 1111646687 | 13:91040371-91040393 | CCCATTCTCTTCAAGATGAGCAG | No data | ||
| Right | 1111646690 | 13:91040421-91040443 | AGAAAACACCACATATGACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1111646687 | Original CRISPR | CTGCTCATCTTGAAGAGAAT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||