ID: 1111646690

View in Genome Browser
Species Human (GRCh38)
Location 13:91040421-91040443
Sequence AGAAAACACCACATATGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111646688_1111646690 26 Left 1111646688 13:91040372-91040394 CCATTCTCTTCAAGATGAGCAGC No data
Right 1111646690 13:91040421-91040443 AGAAAACACCACATATGACCAGG No data
1111646687_1111646690 27 Left 1111646687 13:91040371-91040393 CCCATTCTCTTCAAGATGAGCAG No data
Right 1111646690 13:91040421-91040443 AGAAAACACCACATATGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111646690 Original CRISPR AGAAAACACCACATATGACC AGG Intergenic
No off target data available for this crispr