ID: 1111646866

View in Genome Browser
Species Human (GRCh38)
Location 13:91042145-91042167
Sequence GAAGTCTGAACAATTGACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111646862_1111646866 5 Left 1111646862 13:91042117-91042139 CCTTTAAAATAACCTCTAACCCT No data
Right 1111646866 13:91042145-91042167 GAAGTCTGAACAATTGACTCAGG No data
1111646863_1111646866 -7 Left 1111646863 13:91042129-91042151 CCTCTAACCCTTGTTTGAAGTCT No data
Right 1111646866 13:91042145-91042167 GAAGTCTGAACAATTGACTCAGG No data
1111646860_1111646866 27 Left 1111646860 13:91042095-91042117 CCCTTGGGAAAAGGTTTCTAGAC No data
Right 1111646866 13:91042145-91042167 GAAGTCTGAACAATTGACTCAGG No data
1111646861_1111646866 26 Left 1111646861 13:91042096-91042118 CCTTGGGAAAAGGTTTCTAGACC No data
Right 1111646866 13:91042145-91042167 GAAGTCTGAACAATTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111646866 Original CRISPR GAAGTCTGAACAATTGACTC AGG Intergenic
No off target data available for this crispr