ID: 1111647327

View in Genome Browser
Species Human (GRCh38)
Location 13:91047157-91047179
Sequence CGGAGCTGGCAAGGAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111647319_1111647327 7 Left 1111647319 13:91047127-91047149 CCTCCATGTTATGAGCTGCCTGG No data
Right 1111647327 13:91047157-91047179 CGGAGCTGGCAAGGAACAGAAGG No data
1111647321_1111647327 4 Left 1111647321 13:91047130-91047152 CCATGTTATGAGCTGCCTGGAGT No data
Right 1111647327 13:91047157-91047179 CGGAGCTGGCAAGGAACAGAAGG No data
1111647318_1111647327 12 Left 1111647318 13:91047122-91047144 CCACACCTCCATGTTATGAGCTG No data
Right 1111647327 13:91047157-91047179 CGGAGCTGGCAAGGAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111647327 Original CRISPR CGGAGCTGGCAAGGAACAGA AGG Intergenic
No off target data available for this crispr