ID: 1111648974

View in Genome Browser
Species Human (GRCh38)
Location 13:91066030-91066052
Sequence CGTGCACCCATGACAGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111648974_1111648975 -10 Left 1111648974 13:91066030-91066052 CCTGAGGCTGTCATGGGTGCACG No data
Right 1111648975 13:91066043-91066065 TGGGTGCACGTCCTCAACCTTGG No data
1111648974_1111648981 21 Left 1111648974 13:91066030-91066052 CCTGAGGCTGTCATGGGTGCACG No data
Right 1111648981 13:91066074-91066096 ACATGGATGTGCTTTGGTCAAGG 0: 31
1: 62
2: 40
3: 33
4: 164
1111648974_1111648978 4 Left 1111648974 13:91066030-91066052 CCTGAGGCTGTCATGGGTGCACG No data
Right 1111648978 13:91066057-91066079 CAACCTTGGTGTAAGGTACATGG No data
1111648974_1111648980 15 Left 1111648974 13:91066030-91066052 CCTGAGGCTGTCATGGGTGCACG No data
Right 1111648980 13:91066068-91066090 TAAGGTACATGGATGTGCTTTGG 0: 39
1: 38
2: 57
3: 65
4: 149
1111648974_1111648976 -3 Left 1111648974 13:91066030-91066052 CCTGAGGCTGTCATGGGTGCACG No data
Right 1111648976 13:91066050-91066072 ACGTCCTCAACCTTGGTGTAAGG No data
1111648974_1111648982 27 Left 1111648974 13:91066030-91066052 CCTGAGGCTGTCATGGGTGCACG No data
Right 1111648982 13:91066080-91066102 ATGTGCTTTGGTCAAGGAATAGG 0: 29
1: 34
2: 17
3: 22
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111648974 Original CRISPR CGTGCACCCATGACAGCCTC AGG (reversed) Intergenic
No off target data available for this crispr