ID: 1111655396

View in Genome Browser
Species Human (GRCh38)
Location 13:91145634-91145656
Sequence TTGGTGAGGGGAGGTGTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111655386_1111655396 11 Left 1111655386 13:91145600-91145622 CCTAAATTTAAATTAACGCATAC No data
Right 1111655396 13:91145634-91145656 TTGGTGAGGGGAGGTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111655396 Original CRISPR TTGGTGAGGGGAGGTGTGTG TGG Intergenic
No off target data available for this crispr