ID: 1111656578

View in Genome Browser
Species Human (GRCh38)
Location 13:91161542-91161564
Sequence TATAAAGGTCCAAGCTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111656575_1111656578 13 Left 1111656575 13:91161506-91161528 CCTTTTCACAATTTAAAAACTAG No data
Right 1111656578 13:91161542-91161564 TATAAAGGTCCAAGCTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111656578 Original CRISPR TATAAAGGTCCAAGCTATGC TGG Intergenic
No off target data available for this crispr