ID: 1111656580

View in Genome Browser
Species Human (GRCh38)
Location 13:91161555-91161577
Sequence GCTATGCTGGTAGCTGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111656575_1111656580 26 Left 1111656575 13:91161506-91161528 CCTTTTCACAATTTAAAAACTAG No data
Right 1111656580 13:91161555-91161577 GCTATGCTGGTAGCTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111656580 Original CRISPR GCTATGCTGGTAGCTGCAAC AGG Intergenic
No off target data available for this crispr